\
| Variant ID: vg0414636138 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14636138 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )
AAGGCAGTAATTTCAGACATCCTAAAATGAATTGTGTGAGAGGACGATAAAAACGCCATTTCGATCCATGACTCGAACTACCAGCCATATAGTGATGAGC[G/T]
CTCTCAAAATTATGCAAATATATATACAACGTTTTCTTGGTAAATGCAACTCGATGCCTCCCAAAATTACAATAGATCTGGTTAATGCAGCAACATAGCG
CGCTATGTTGCTGCATTAACCAGATCTATTGTAATTTTGGGAGGCATCGAGTTGCATTTACCAAGAAAACGTTGTATATATATTTGCATAATTTTGAGAG[C/A]
GCTCATCACTATATGGCTGGTAGTTCGAGTCATGGATCGAAATGGCGTTTTTATCGTCCTCTCACACAATTCATTTTAGGATGTCTGAAATTACTGCCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 9.60% | 0.36% | 2.54% | NA |
| All Indica | 2759 | 97.70% | 0.50% | 0.07% | 1.74% | NA |
| All Japonica | 1512 | 66.00% | 28.40% | 0.86% | 4.76% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.70% | 0.22% | 0.65% | NA |
| Indica III | 913 | 96.40% | 0.30% | 0.00% | 3.29% | NA |
| Indica Intermediate | 786 | 97.60% | 0.40% | 0.13% | 1.91% | NA |
| Temperate Japonica | 767 | 88.70% | 3.50% | 0.52% | 7.30% | NA |
| Tropical Japonica | 504 | 26.80% | 71.20% | 1.59% | 0.40% | NA |
| Japonica Intermediate | 241 | 75.90% | 17.80% | 0.41% | 5.81% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414636138 | G -> DEL | N | N | silent_mutation | Average:19.177; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| vg0414636138 | G -> T | LOC_Os04g25320.1 | upstream_gene_variant ; 4670.0bp to feature; MODIFIER | silent_mutation | Average:19.177; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| vg0414636138 | G -> T | LOC_Os04g25310-LOC_Os04g25320 | intergenic_region ; MODIFIER | silent_mutation | Average:19.177; most accessible tissue: Minghui63 young leaf, score: 28.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414636138 | NA | 3.11E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | 7.49E-09 | 3.41E-28 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 1.26E-16 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | 6.12E-06 | 2.56E-18 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 6.04E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | 9.25E-07 | 1.05E-10 | mr1993 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | 9.97E-06 | 2.65E-11 | mr1993 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | 4.30E-08 | 2.87E-28 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 3.51E-17 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | 1.73E-06 | 3.94E-20 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 2.80E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 5.58E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 3.13E-14 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414636138 | NA | 1.25E-14 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |