Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414636138:

Variant ID: vg0414636138 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14636138
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGCAGTAATTTCAGACATCCTAAAATGAATTGTGTGAGAGGACGATAAAAACGCCATTTCGATCCATGACTCGAACTACCAGCCATATAGTGATGAGC[G/T]
CTCTCAAAATTATGCAAATATATATACAACGTTTTCTTGGTAAATGCAACTCGATGCCTCCCAAAATTACAATAGATCTGGTTAATGCAGCAACATAGCG

Reverse complement sequence

CGCTATGTTGCTGCATTAACCAGATCTATTGTAATTTTGGGAGGCATCGAGTTGCATTTACCAAGAAAACGTTGTATATATATTTGCATAATTTTGAGAG[C/A]
GCTCATCACTATATGGCTGGTAGTTCGAGTCATGGATCGAAATGGCGTTTTTATCGTCCTCTCACACAATTCATTTTAGGATGTCTGAAATTACTGCCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	9.60%	0.36%	2.54%	NA
All Indica	2759	97.70%	0.50%	0.07%	1.74%	NA
All Japonica	1512	66.00%	28.40%	0.86%	4.76%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	1.70%	0.22%	0.65%	NA
Indica III	913	96.40%	0.30%	0.00%	3.29%	NA
Indica Intermediate	786	97.60%	0.40%	0.13%	1.91%	NA
Temperate Japonica	767	88.70%	3.50%	0.52%	7.30%	NA
Tropical Japonica	504	26.80%	71.20%	1.59%	0.40%	NA
Japonica Intermediate	241	75.90%	17.80%	0.41%	5.81%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414636138	G -> DEL	N	N	silent_mutation	Average:19.177; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0414636138	G -> T	LOC_Os04g25320.1	upstream_gene_variant ; 4670.0bp to feature; MODIFIER	silent_mutation	Average:19.177; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N
vg0414636138	G -> T	LOC_Os04g25310-LOC_Os04g25320	intergenic_region ; MODIFIER	silent_mutation	Average:19.177; most accessible tissue: Minghui63 young leaf, score: 28.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414636138	NA	3.11E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	7.49E-09	3.41E-28	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	1.26E-16	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	6.12E-06	2.56E-18	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	6.04E-12	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	9.25E-07	1.05E-10	mr1993	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	9.97E-06	2.65E-11	mr1993	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	4.30E-08	2.87E-28	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	3.51E-17	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	1.73E-06	3.94E-20	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	2.80E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	5.58E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	3.13E-14	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414636138	NA	1.25E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251