\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414604268:

Variant ID: vg0414604268 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14604268
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAGAAAATTATTCATATGCCCTGGAAAGGTTGCCACCTGCCTCAAATTAATGACACATTCAATAAAGCTGTACACAAAAAAATTACAGGACACATTTC[G/A]
CGAGAAAAGAGTGGTTAAAAGGTGTGGTTTCGTAGAAACCACGCCTTTTAACCAATGATATCTGGAATAACAAATGAACTGCTTAACCTTTCTTGGAAAG

Reverse complement sequence

CTTTCCAAGAAAGGTTAAGCAGTTCATTTGTTATTCCAGATATCATTGGTTAAAAGGCGTGGTTTCTACGAAACCACACCTTTTAACCACTCTTTTCTCG[C/T]
GAAATGTGTCCTGTAATTTTTTTGTGTACAGCTTTATTGAATGTGTCATTAATTTGAGGCAGGTGGCAACCTTTCCAGGGCATATGAATAATTTTCTATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 8.70% 1.44% 1.44% NA
All Indica  2759 99.00% 0.50% 0.29% 0.22% NA
All Japonica  1512 68.30% 25.70% 2.65% 3.44% NA
Aus  269 98.50% 0.00% 1.12% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 1.90% 0.65% 0.00% NA
Indica III  913 99.50% 0.20% 0.22% 0.11% NA
Indica Intermediate  786 98.60% 0.40% 0.38% 0.64% NA
Temperate Japonica  767 93.40% 1.60% 1.04% 4.04% NA
Tropical Japonica  504 26.00% 67.70% 4.76% 1.59% NA
Japonica Intermediate  241 76.80% 14.50% 3.32% 5.39% NA
VI/Aromatic  96 76.00% 0.00% 16.67% 7.29% NA
Intermediate  90 86.70% 10.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414604268 G -> DEL N N silent_mutation Average:15.249; most accessible tissue: Zhenshan97 flower, score: 21.513 N N N N
vg0414604268 G -> A LOC_Os04g25270.1 upstream_gene_variant ; 895.0bp to feature; MODIFIER silent_mutation Average:15.249; most accessible tissue: Zhenshan97 flower, score: 21.513 N N N N
vg0414604268 G -> A LOC_Os04g25280.1 upstream_gene_variant ; 4515.0bp to feature; MODIFIER silent_mutation Average:15.249; most accessible tissue: Zhenshan97 flower, score: 21.513 N N N N
vg0414604268 G -> A LOC_Os04g25260-LOC_Os04g25270 intergenic_region ; MODIFIER silent_mutation Average:15.249; most accessible tissue: Zhenshan97 flower, score: 21.513 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414604268 NA 1.36E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 3.04E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.80E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 9.19E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 2.87E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 4.83E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.41E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 3.55E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.36E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 8.56E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 5.67E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.78E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 7.93E-08 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.41E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 6.29E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.52E-18 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 7.69E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 2.56E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.22E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 2.34E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 2.55E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 6.15E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 5.93E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 3.11E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.73E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 3.13E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 1.23E-06 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 2.27E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 7.62E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.43E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 4.13E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414604268 NA 1.55E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251