\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414588084:

Variant ID: vg0414588084 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14588084
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.11, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTTTACCCTGTGCAGCCATTGATCTCACTTTCGTGCTTGCTGATGGTCAGGGCGCTCATCCTCCTGCCGGACGCGGTTGCTTCGGCCGAGGTCGCTC[T/G]
CCATGGCCGATGTGCTCCGGCTGTGTACATGTTGTTGCTCCGCCGTCGGTCGGTGTGTATTGTTGGTGCGGCTGGATAGGAATAGATGGATGGATGTGTT

Reverse complement sequence

AACACATCCATCCATCTATTCCTATCCAGCCGCACCAACAATACACACCGACCGACGGCGGAGCAACAACATGTACACAGCCGGAGCACATCGGCCATGG[A/C]
GAGCGACCTCGGCCGAAGCAACCGCGTCCGGCAGGAGGATGAGCGCCCTGACCATCAGCAAGCACGAAAGTGAGATCAATGGCTGCACAGGGTAAAGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 5.50% 23.66% 16.53% NA
All Indica  2759 63.10% 9.00% 20.80% 7.07% NA
All Japonica  1512 46.20% 0.20% 19.18% 34.46% NA
Aus  269 4.80% 0.40% 83.27% 11.52% NA
Indica I  595 57.00% 1.20% 33.61% 8.24% NA
Indica II  465 27.70% 37.40% 21.51% 13.33% NA
Indica III  913 82.10% 0.20% 12.71% 4.93% NA
Indica Intermediate  786 66.70% 8.30% 20.10% 4.96% NA
Temperate Japonica  767 60.20% 0.00% 19.04% 20.73% NA
Tropical Japonica  504 22.40% 0.20% 16.87% 60.52% NA
Japonica Intermediate  241 51.00% 0.80% 24.48% 23.65% NA
VI/Aromatic  96 62.50% 1.00% 16.67% 19.79% NA
Intermediate  90 62.20% 5.60% 15.56% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414588084 T -> DEL LOC_Os04g25230.1 N frameshift_variant Average:63.683; most accessible tissue: Minghui63 young leaf, score: 91.282 N N N N
vg0414588084 T -> G LOC_Os04g25230.1 missense_variant ; p.Glu2Ala; MODERATE nonsynonymous_codon ; E2A Average:63.683; most accessible tissue: Minghui63 young leaf, score: 91.282 unknown unknown TOLERATED 0.99

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0414588084 T G -0.01 -0.03 -0.01 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414588084 NA 5.40E-10 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 2.50E-07 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 1.86E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 2.19E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 1.26E-06 mr1096 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 1.90E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 1.90E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 3.03E-06 mr1131 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 4.19E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 1.15E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 1.54E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 2.04E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 3.54E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414588084 NA 7.14E-07 mr1989 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251