Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414587628:

Variant ID: vg0414587628 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14587628
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGTCTCATGTATTGTGGATGCAAGCAGCTCGGTGACGTCCACATCGGCTCCAACGACCCTCGACGTAGTACAGCAGGGTAGCGACAATGGAGAGAGCG[A/T]
GCATCATGGACAGATAGCTTCGCTCTTGACATGATGGGGAGAAAAAAAAAACTCCGATGTGACGAAGGGCAGGTTCCCCTGACGAGCAGCACGACGACAA

Reverse complement sequence

TTGTCGTCGTGCTGCTCGTCAGGGGAACCTGCCCTTCGTCACATCGGAGTTTTTTTTTTCTCCCCATCATGTCAAGAGCGAAGCTATCTGTCCATGATGC[T/A]
CGCTCTCTCCATTGTCGCTACCCTGCTGTACTACGTCGAGGGTCGTTGGAGCCGATGTGGACGTCACCGAGCTGCTTGCATCCACAATACATGAGACCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 4.90% 3.83% 11.05% NA
All Indica  2759 88.90% 6.60% 2.97% 1.45% NA
All Japonica  1512 61.20% 2.50% 6.02% 30.22% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 85.00% 8.20% 4.03% 2.69% NA
Indica II  465 96.10% 2.40% 0.86% 0.65% NA
Indica III  913 87.70% 7.30% 3.50% 1.42% NA
Indica Intermediate  786 89.10% 7.10% 2.80% 1.02% NA
Temperate Japonica  767 81.90% 1.00% 3.26% 13.82% NA
Tropical Japonica  504 24.20% 4.80% 11.11% 59.92% NA
Japonica Intermediate  241 73.00% 2.50% 4.15% 20.33% NA
VI/Aromatic  96 72.90% 3.10% 4.17% 19.79% NA
Intermediate  90 81.10% 7.80% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414587628 A -> DEL N N silent_mutation Average:55.263; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg0414587628 A -> T LOC_Os04g25250.1 downstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:55.263; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N
vg0414587628 A -> T LOC_Os04g25230.1 intron_variant ; MODIFIER silent_mutation Average:55.263; most accessible tissue: Minghui63 flag leaf, score: 85.67 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0414587628 A T 0.02 0.0 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414587628 NA 6.68E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 7.18E-06 7.18E-06 mr1736 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 4.87E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 8.86E-08 8.86E-08 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 8.47E-06 8.47E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 6.79E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 5.16E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 7.20E-07 7.20E-07 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 3.81E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 2.06E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 1.68E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 NA 3.95E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 8.96E-06 8.95E-06 mr1822_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414587628 4.89E-06 4.89E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251