\
| Variant ID: vg0414583385 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14583385 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAAGGGATCGATACCAGCATGCAGAATTGCGCGGCAAAAGTGTATGCCCCAGAAAAAAAATTATACTATTTGTTAAGACAATGACAGGCGAAGGTCCATG[T/C]
CGCAAATTCATTCTTCCAACTAGACGGATGGCACATGTTAGTCTGAAGAATTGTGAGGCGAAAACGTGCCTTCGATAAACAATTATATATTTCTTAAAAC
GTTTTAAGAAATATATAATTGTTTATCGAAGGCACGTTTTCGCCTCACAATTCTTCAGACTAACATGTGCCATCCGTCTAGTTGGAAGAATGAATTTGCG[A/G]
CATGGACCTTCGCCTGTCATTGTCTTAACAAATAGTATAATTTTTTTTCTGGGGCATACACTTTTGCCGCGCAATTCTGCATGCTGGTATCGATCCCTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 25.40% | 1.84% | 7.28% | NA |
| All Indica | 2759 | 75.00% | 16.20% | 2.54% | 6.23% | NA |
| All Japonica | 1512 | 58.90% | 30.70% | 0.99% | 9.46% | NA |
| Aus | 269 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.00% | 9.70% | 3.53% | 21.68% | NA |
| Indica II | 465 | 66.90% | 32.30% | 0.65% | 0.22% | NA |
| Indica III | 913 | 82.60% | 13.30% | 2.41% | 1.75% | NA |
| Indica Intermediate | 786 | 78.60% | 15.00% | 3.05% | 3.31% | NA |
| Temperate Japonica | 767 | 81.20% | 4.30% | 0.52% | 13.95% | NA |
| Tropical Japonica | 504 | 22.60% | 73.00% | 1.39% | 2.98% | NA |
| Japonica Intermediate | 241 | 63.50% | 26.10% | 1.66% | 8.71% | NA |
| VI/Aromatic | 96 | 64.60% | 8.30% | 1.04% | 26.04% | NA |
| Intermediate | 90 | 70.00% | 24.40% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414583385 | T -> C | LOC_Os04g25210.1 | upstream_gene_variant ; 4873.0bp to feature; MODIFIER | silent_mutation | Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0414583385 | T -> C | LOC_Os04g25220.1 | downstream_gene_variant ; 2346.0bp to feature; MODIFIER | silent_mutation | Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0414583385 | T -> C | LOC_Os04g25230.1 | downstream_gene_variant ; 3265.0bp to feature; MODIFIER | silent_mutation | Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0414583385 | T -> C | LOC_Os04g25220-LOC_Os04g25230 | intergenic_region ; MODIFIER | silent_mutation | Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| vg0414583385 | T -> DEL | N | N | silent_mutation | Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414583385 | NA | 2.82E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414583385 | 3.47E-06 | 3.47E-06 | mr1370 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414583385 | NA | 8.11E-08 | mr1637 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414583385 | NA | 2.67E-07 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414583385 | NA | 2.67E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414583385 | NA | 9.50E-07 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |