\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414583385:

Variant ID: vg0414583385 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14583385
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGGGATCGATACCAGCATGCAGAATTGCGCGGCAAAAGTGTATGCCCCAGAAAAAAAATTATACTATTTGTTAAGACAATGACAGGCGAAGGTCCATG[T/C]
CGCAAATTCATTCTTCCAACTAGACGGATGGCACATGTTAGTCTGAAGAATTGTGAGGCGAAAACGTGCCTTCGATAAACAATTATATATTTCTTAAAAC

Reverse complement sequence

GTTTTAAGAAATATATAATTGTTTATCGAAGGCACGTTTTCGCCTCACAATTCTTCAGACTAACATGTGCCATCCGTCTAGTTGGAAGAATGAATTTGCG[A/G]
CATGGACCTTCGCCTGTCATTGTCTTAACAAATAGTATAATTTTTTTTCTGGGGCATACACTTTTGCCGCGCAATTCTGCATGCTGGTATCGATCCCTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 25.40% 1.84% 7.28% NA
All Indica  2759 75.00% 16.20% 2.54% 6.23% NA
All Japonica  1512 58.90% 30.70% 0.99% 9.46% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 65.00% 9.70% 3.53% 21.68% NA
Indica II  465 66.90% 32.30% 0.65% 0.22% NA
Indica III  913 82.60% 13.30% 2.41% 1.75% NA
Indica Intermediate  786 78.60% 15.00% 3.05% 3.31% NA
Temperate Japonica  767 81.20% 4.30% 0.52% 13.95% NA
Tropical Japonica  504 22.60% 73.00% 1.39% 2.98% NA
Japonica Intermediate  241 63.50% 26.10% 1.66% 8.71% NA
VI/Aromatic  96 64.60% 8.30% 1.04% 26.04% NA
Intermediate  90 70.00% 24.40% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414583385 T -> C LOC_Os04g25210.1 upstream_gene_variant ; 4873.0bp to feature; MODIFIER silent_mutation Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0414583385 T -> C LOC_Os04g25220.1 downstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0414583385 T -> C LOC_Os04g25230.1 downstream_gene_variant ; 3265.0bp to feature; MODIFIER silent_mutation Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0414583385 T -> C LOC_Os04g25220-LOC_Os04g25230 intergenic_region ; MODIFIER silent_mutation Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0414583385 T -> DEL N N silent_mutation Average:27.942; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414583385 NA 2.82E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385 3.47E-06 3.47E-06 mr1370 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385 NA 8.11E-08 mr1637 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385 NA 2.67E-07 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385 NA 2.67E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414583385 NA 9.50E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251