| Variant ID: vg0414554740 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14554740 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.18, others allele: 0.00, population size: 97. )
AGCTAAAACTAGCACCTATAGTGTTTTGCCCACCTCCACAGGCTGAAAATACAAAAAAAAAATCCATCACCTTTAAGTGAATATAGGTGCCGGTTTAATA[T/G]
AAAAACCAATACCTATACTATAAGTGCTATTTTTTTAAAAAAAACCGACAATTATAATATATTAAAAACCGCCAGCTATAATATATTATCGGTGCCGGTA
TACCGGCACCGATAATATATTATAGCTGGCGGTTTTTAATATATTATAATTGTCGGTTTTTTTTAAAAAAATAGCACTTATAGTATAGGTATTGGTTTTT[A/C]
TATTAAACCGGCACCTATATTCACTTAAAGGTGATGGATTTTTTTTTTGTATTTTCAGCCTGTGGAGGTGGGCAAAACACTATAGGTGCTAGTTTTAGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.00% | 18.80% | 10.75% | 23.51% | NA |
| All Indica | 2759 | 51.40% | 6.10% | 10.58% | 31.97% | NA |
| All Japonica | 1512 | 46.20% | 40.70% | 0.40% | 12.70% | NA |
| Aus | 269 | 3.00% | 30.90% | 65.06% | 1.12% | NA |
| Indica I | 595 | 41.20% | 1.00% | 1.68% | 56.13% | NA |
| Indica II | 465 | 20.40% | 9.20% | 23.44% | 46.88% | NA |
| Indica III | 913 | 76.50% | 7.30% | 10.08% | 6.13% | NA |
| Indica Intermediate | 786 | 48.30% | 6.50% | 10.31% | 34.86% | NA |
| Temperate Japonica | 767 | 59.10% | 25.70% | 0.13% | 15.12% | NA |
| Tropical Japonica | 504 | 22.60% | 68.10% | 0.79% | 8.53% | NA |
| Japonica Intermediate | 241 | 54.40% | 31.50% | 0.41% | 13.69% | NA |
| VI/Aromatic | 96 | 53.10% | 1.00% | 32.29% | 13.54% | NA |
| Intermediate | 90 | 48.90% | 23.30% | 4.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414554740 | T -> DEL | N | N | silent_mutation | Average:14.594; most accessible tissue: Callus, score: 33.681 | N | N | N | N |
| vg0414554740 | T -> G | LOC_Os04g25180.1 | upstream_gene_variant ; 934.0bp to feature; MODIFIER | silent_mutation | Average:14.594; most accessible tissue: Callus, score: 33.681 | N | N | N | N |
| vg0414554740 | T -> G | LOC_Os04g25190.1 | downstream_gene_variant ; 4180.0bp to feature; MODIFIER | silent_mutation | Average:14.594; most accessible tissue: Callus, score: 33.681 | N | N | N | N |
| vg0414554740 | T -> G | LOC_Os04g25170-LOC_Os04g25180 | intergenic_region ; MODIFIER | silent_mutation | Average:14.594; most accessible tissue: Callus, score: 33.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414554740 | NA | 7.33E-06 | mr1227 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | NA | 6.37E-07 | mr1749 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | NA | 2.25E-07 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | NA | 6.48E-07 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | NA | 1.34E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | NA | 8.36E-06 | mr1338_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | 2.74E-06 | NA | mr1712_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414554740 | NA | 3.91E-06 | mr1712_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/