\
| Variant ID: vg0414551751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14551751 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.44, others allele: 0.00, population size: 80. )
TCATTGTGTACCTGCCTAAAATTTTCCCTATAAGAGTTTGGGCTGGGTAGGTACAAGTTGTAGGAGCTTTGGTGAAAATGATGATCAGCTACAACGAAAA[G/A]
TAGACACGTGTCACATGTGGGATTGAGGTGCAGATGCACCTAGGTTCATATTATCCAACTCCTATATATATATATACATATACATATACATATATATATA
TATATATATATGTATATGTATATGTATATATATATATAGGAGTTGGATAATATGAACCTAGGTGCATCTGCACCTCAATCCCACATGTGACACGTGTCTA[C/T]
TTTTCGTTGTAGCTGATCATCATTTTCACCAAAGCTCCTACAACTTGTACCTACCCAGCCCAAACTCTTATAGGGAAAATTTTAGGCAGGTACACAATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 39.20% | 1.06% | 8.51% | NA |
| All Indica | 2759 | 51.00% | 40.20% | 1.49% | 7.39% | NA |
| All Japonica | 1512 | 60.60% | 26.90% | 0.20% | 12.30% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 41.70% | 30.80% | 0.67% | 26.89% | NA |
| Indica II | 465 | 18.50% | 78.10% | 3.23% | 0.22% | NA |
| Indica III | 913 | 76.80% | 21.10% | 1.20% | 0.88% | NA |
| Indica Intermediate | 786 | 47.20% | 46.90% | 1.40% | 4.45% | NA |
| Temperate Japonica | 767 | 82.30% | 2.60% | 0.13% | 14.99% | NA |
| Tropical Japonica | 504 | 23.60% | 67.70% | 0.20% | 8.53% | NA |
| Japonica Intermediate | 241 | 68.90% | 19.10% | 0.41% | 11.62% | NA |
| VI/Aromatic | 96 | 53.10% | 34.40% | 4.17% | 8.33% | NA |
| Intermediate | 90 | 50.00% | 43.30% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414551751 | G -> DEL | N | N | silent_mutation | Average:14.725; most accessible tissue: Callus, score: 35.369 | N | N | N | N |
| vg0414551751 | G -> A | LOC_Os04g25180.1 | upstream_gene_variant ; 3923.0bp to feature; MODIFIER | silent_mutation | Average:14.725; most accessible tissue: Callus, score: 35.369 | N | N | N | N |
| vg0414551751 | G -> A | LOC_Os04g25170.1 | downstream_gene_variant ; 3333.0bp to feature; MODIFIER | silent_mutation | Average:14.725; most accessible tissue: Callus, score: 35.369 | N | N | N | N |
| vg0414551751 | G -> A | LOC_Os04g25170-LOC_Os04g25180 | intergenic_region ; MODIFIER | silent_mutation | Average:14.725; most accessible tissue: Callus, score: 35.369 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414551751 | NA | 2.42E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 5.62E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 1.29E-07 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 9.18E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | 9.00E-07 | 8.96E-07 | mr1736 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 3.92E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 2.32E-08 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 7.33E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 1.39E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 6.43E-06 | mr1319_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 2.01E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 1.24E-16 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414551751 | NA | 2.70E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |