\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414546553:

Variant ID: vg0414546553 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14546553
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGCCTACTAGGAGTCGTCCCTTTTTCTCGATGGGCAAGGTCCTCCTTTTATAGTTCAAGGGGATACTACATGCACCGCTTCTACCTACTCTATCACG[A/G]
GAGGGGGACCCACTCTACTCAGACCGGACCACGATCCATGCCTTCGCCCAGAAGCTAAGCGGCCGTCCGTCCTCGAGTGGGACCCAGCACCACCTCCCGC

Reverse complement sequence

GCGGGAGGTGGTGCTGGGTCCCACTCGAGGACGGACGGCCGCTTAGCTTCTGGGCGAAGGCATGGATCGTGGTCCGGTCTGAGTAGAGTGGGTCCCCCTC[T/C]
CGTGATAGAGTAGGTAGAAGCGGTGCATGTAGTATCCCCTTGAACTATAAAAGGAGGACCTTGCCCATCGAGAAAAAGGGACGACTCCTAGTAGGCCTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.00% 2.90% 14.30% 62.82% NA
All Indica  2759 7.00% 2.30% 15.80% 74.92% NA
All Japonica  1512 47.50% 4.40% 12.43% 35.71% NA
Aus  269 1.10% 0.00% 12.64% 86.25% NA
Indica I  595 18.30% 1.00% 11.93% 68.74% NA
Indica II  465 4.30% 1.50% 13.33% 80.86% NA
Indica III  913 3.30% 3.50% 18.84% 74.37% NA
Indica Intermediate  786 4.20% 2.40% 16.67% 76.72% NA
Temperate Japonica  767 83.40% 1.30% 3.13% 12.13% NA
Tropical Japonica  504 3.20% 6.00% 27.98% 62.90% NA
Japonica Intermediate  241 25.70% 10.80% 9.54% 53.94% NA
VI/Aromatic  96 4.20% 1.00% 6.25% 88.54% NA
Intermediate  90 31.10% 5.60% 13.33% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414546553 A -> DEL N N silent_mutation Average:32.196; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0414546553 A -> G LOC_Os04g25160.1 upstream_gene_variant ; 2185.0bp to feature; MODIFIER silent_mutation Average:32.196; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0414546553 A -> G LOC_Os04g25170.1 upstream_gene_variant ; 1428.0bp to feature; MODIFIER silent_mutation Average:32.196; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0414546553 A -> G LOC_Os04g25160-LOC_Os04g25170 intergenic_region ; MODIFIER silent_mutation Average:32.196; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414546553 NA 4.58E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.23E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 6.07E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 2.24E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 4.38E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.66E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 3.12E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 3.78E-06 NA mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.60E-10 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.54E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.05E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 3.12E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 4.02E-06 4.01E-06 mr1736 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 7.58E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.73E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.58E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 9.44E-06 NA mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 3.73E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 2.07E-09 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 3.39E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414546553 NA 1.06E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251