Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414544689:

Variant ID: vg0414544689 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14544689
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AATTAGTCACCTCCTCATGATCCGTTCATTGAGCATGTGGACCCATGCATGATCAAATTGGGAGGGGGGTGGATATGCCAGTGGAAGATAGATGGGTGGC[T/C]
GAGAAAATGGTTAGGAATGATGAGCAAGGCACCGAGGGGCACCGTGTGGCATGCATATATAGTATTCTTGGCAGAGGTGCAATCAACAGTTCAATGTTGA

Reverse complement sequence

TCAACATTGAACTGTTGATTGCACCTCTGCCAAGAATACTATATATGCATGCCACACGGTGCCCCTCGGTGCCTTGCTCATCATTCCTAACCATTTTCTC[A/G]
GCCACCCATCTATCTTCCACTGGCATATCCACCCCCCTCCCAATTTGATCATGCATGGGTCCACATGCTCAATGAACGGATCATGAGGAGGTGACTAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	20.40%	21.79%	13.77%	NA
All Indica	2759	49.80%	6.60%	32.37%	11.27%	NA
All Japonica	1512	41.20%	49.50%	1.19%	8.13%	NA
Aus	269	1.90%	1.10%	26.02%	71.00%	NA
Indica I	595	38.30%	18.00%	30.42%	13.28%	NA
Indica II	465	17.80%	3.90%	59.57%	18.71%	NA
Indica III	913	76.20%	2.40%	14.79%	6.57%	NA
Indica Intermediate	786	46.60%	4.50%	38.17%	10.81%	NA
Temperate Japonica	767	6.10%	84.00%	0.91%	9.00%	NA
Tropical Japonica	504	87.10%	4.80%	1.19%	6.94%	NA
Japonica Intermediate	241	56.80%	33.20%	2.07%	7.88%	NA
VI/Aromatic	96	50.00%	4.20%	30.21%	15.62%	NA
Intermediate	90	35.60%	30.00%	22.22%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414544689	T -> C	LOC_Os04g25160.1	upstream_gene_variant ; 321.0bp to feature; MODIFIER	silent_mutation	Average:16.682; most accessible tissue: Callus, score: 27.532	N	N	N	N
vg0414544689	T -> C	LOC_Os04g25170.1	upstream_gene_variant ; 3292.0bp to feature; MODIFIER	silent_mutation	Average:16.682; most accessible tissue: Callus, score: 27.532	N	N	N	N
vg0414544689	T -> C	LOC_Os04g25160-LOC_Os04g25170	intergenic_region ; MODIFIER	silent_mutation	Average:16.682; most accessible tissue: Callus, score: 27.532	N	N	N	N
vg0414544689	T -> DEL	N	N	silent_mutation	Average:16.682; most accessible tissue: Callus, score: 27.532	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414544689	NA	1.87E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689	NA	2.57E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689	NA	3.80E-15	mr1712	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689	NA	8.29E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689	NA	1.27E-07	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689	NA	1.06E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251