| Variant ID: vg0414544689 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14544689 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 101. )
AATTAGTCACCTCCTCATGATCCGTTCATTGAGCATGTGGACCCATGCATGATCAAATTGGGAGGGGGGTGGATATGCCAGTGGAAGATAGATGGGTGGC[T/C]
GAGAAAATGGTTAGGAATGATGAGCAAGGCACCGAGGGGCACCGTGTGGCATGCATATATAGTATTCTTGGCAGAGGTGCAATCAACAGTTCAATGTTGA
TCAACATTGAACTGTTGATTGCACCTCTGCCAAGAATACTATATATGCATGCCACACGGTGCCCCTCGGTGCCTTGCTCATCATTCCTAACCATTTTCTC[A/G]
GCCACCCATCTATCTTCCACTGGCATATCCACCCCCCTCCCAATTTGATCATGCATGGGTCCACATGCTCAATGAACGGATCATGAGGAGGTGACTAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.00% | 20.40% | 21.79% | 13.77% | NA |
| All Indica | 2759 | 49.80% | 6.60% | 32.37% | 11.27% | NA |
| All Japonica | 1512 | 41.20% | 49.50% | 1.19% | 8.13% | NA |
| Aus | 269 | 1.90% | 1.10% | 26.02% | 71.00% | NA |
| Indica I | 595 | 38.30% | 18.00% | 30.42% | 13.28% | NA |
| Indica II | 465 | 17.80% | 3.90% | 59.57% | 18.71% | NA |
| Indica III | 913 | 76.20% | 2.40% | 14.79% | 6.57% | NA |
| Indica Intermediate | 786 | 46.60% | 4.50% | 38.17% | 10.81% | NA |
| Temperate Japonica | 767 | 6.10% | 84.00% | 0.91% | 9.00% | NA |
| Tropical Japonica | 504 | 87.10% | 4.80% | 1.19% | 6.94% | NA |
| Japonica Intermediate | 241 | 56.80% | 33.20% | 2.07% | 7.88% | NA |
| VI/Aromatic | 96 | 50.00% | 4.20% | 30.21% | 15.62% | NA |
| Intermediate | 90 | 35.60% | 30.00% | 22.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414544689 | T -> C | LOC_Os04g25160.1 | upstream_gene_variant ; 321.0bp to feature; MODIFIER | silent_mutation | Average:16.682; most accessible tissue: Callus, score: 27.532 | N | N | N | N |
| vg0414544689 | T -> C | LOC_Os04g25170.1 | upstream_gene_variant ; 3292.0bp to feature; MODIFIER | silent_mutation | Average:16.682; most accessible tissue: Callus, score: 27.532 | N | N | N | N |
| vg0414544689 | T -> C | LOC_Os04g25160-LOC_Os04g25170 | intergenic_region ; MODIFIER | silent_mutation | Average:16.682; most accessible tissue: Callus, score: 27.532 | N | N | N | N |
| vg0414544689 | T -> DEL | N | N | silent_mutation | Average:16.682; most accessible tissue: Callus, score: 27.532 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414544689 | NA | 1.87E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414544689 | NA | 2.57E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414544689 | NA | 3.80E-15 | mr1712 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414544689 | NA | 8.29E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414544689 | NA | 1.27E-07 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414544689 | NA | 1.06E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |