\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414544689:

Variant ID: vg0414544689 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14544689
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAGTCACCTCCTCATGATCCGTTCATTGAGCATGTGGACCCATGCATGATCAAATTGGGAGGGGGGTGGATATGCCAGTGGAAGATAGATGGGTGGC[T/C]
GAGAAAATGGTTAGGAATGATGAGCAAGGCACCGAGGGGCACCGTGTGGCATGCATATATAGTATTCTTGGCAGAGGTGCAATCAACAGTTCAATGTTGA

Reverse complement sequence

TCAACATTGAACTGTTGATTGCACCTCTGCCAAGAATACTATATATGCATGCCACACGGTGCCCCTCGGTGCCTTGCTCATCATTCCTAACCATTTTCTC[A/G]
GCCACCCATCTATCTTCCACTGGCATATCCACCCCCCTCCCAATTTGATCATGCATGGGTCCACATGCTCAATGAACGGATCATGAGGAGGTGACTAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 20.40% 21.79% 13.77% NA
All Indica  2759 49.80% 6.60% 32.37% 11.27% NA
All Japonica  1512 41.20% 49.50% 1.19% 8.13% NA
Aus  269 1.90% 1.10% 26.02% 71.00% NA
Indica I  595 38.30% 18.00% 30.42% 13.28% NA
Indica II  465 17.80% 3.90% 59.57% 18.71% NA
Indica III  913 76.20% 2.40% 14.79% 6.57% NA
Indica Intermediate  786 46.60% 4.50% 38.17% 10.81% NA
Temperate Japonica  767 6.10% 84.00% 0.91% 9.00% NA
Tropical Japonica  504 87.10% 4.80% 1.19% 6.94% NA
Japonica Intermediate  241 56.80% 33.20% 2.07% 7.88% NA
VI/Aromatic  96 50.00% 4.20% 30.21% 15.62% NA
Intermediate  90 35.60% 30.00% 22.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414544689 T -> C LOC_Os04g25160.1 upstream_gene_variant ; 321.0bp to feature; MODIFIER silent_mutation Average:16.682; most accessible tissue: Callus, score: 27.532 N N N N
vg0414544689 T -> C LOC_Os04g25170.1 upstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:16.682; most accessible tissue: Callus, score: 27.532 N N N N
vg0414544689 T -> C LOC_Os04g25160-LOC_Os04g25170 intergenic_region ; MODIFIER silent_mutation Average:16.682; most accessible tissue: Callus, score: 27.532 N N N N
vg0414544689 T -> DEL N N silent_mutation Average:16.682; most accessible tissue: Callus, score: 27.532 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414544689 NA 1.87E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689 NA 2.57E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689 NA 3.80E-15 mr1712 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689 NA 8.29E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689 NA 1.27E-07 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414544689 NA 1.06E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251