\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414540932:

Variant ID: vg0414540932 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14540932
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAAGTCCTACTTGAAGGGGATAAAGTTTATATTGTATCGTACGGGATCTGATGTTCCCGAGTCTATACTCCAAAATAGTTATACCACTGGTCTGACC[T/G]
CTGCTGTACCGCCGGTCTGACCGGTGTATCTATACACGTAGTAGGAATCCGTTACAAATTATGGAAAATATCTCTACGAGTTAAGTGATTTCCAAAGTCC

Reverse complement sequence

GGACTTTGGAAATCACTTAACTCGTAGAGATATTTTCCATAATTTGTAACGGATTCCTACTACGTGTATAGATACACCGGTCAGACCGGCGGTACAGCAG[A/C]
GGTCAGACCAGTGGTATAACTATTTTGGAGTATAGACTCGGGAACATCAGATCCCGTACGATACAATATAAACTTTATCCCCTTCAAGTAGGACTTTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 19.60% 0.55% 0.00% NA
All Indica  2759 93.30% 6.00% 0.65% 0.00% NA
All Japonica  1512 51.30% 48.30% 0.40% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 82.40% 17.30% 0.34% 0.00% NA
Indica II  465 94.40% 3.20% 2.37% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 3.60% 0.64% 0.00% NA
Temperate Japonica  767 16.70% 82.70% 0.65% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 68.50% 31.10% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414540932 T -> G LOC_Os04g25160.1 downstream_gene_variant ; 2745.0bp to feature; MODIFIER silent_mutation Average:43.269; most accessible tissue: Callus, score: 53.346 N N N N
vg0414540932 T -> G LOC_Os04g25150-LOC_Os04g25160 intergenic_region ; MODIFIER silent_mutation Average:43.269; most accessible tissue: Callus, score: 53.346 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414540932 NA 1.21E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 3.85E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 2.12E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 8.54E-15 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 1.58E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 3.65E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 2.57E-09 mr1837 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 4.65E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932 NA 2.00E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251