Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414540932:

Variant ID: vg0414540932 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14540932
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TCCAAAGTCCTACTTGAAGGGGATAAAGTTTATATTGTATCGTACGGGATCTGATGTTCCCGAGTCTATACTCCAAAATAGTTATACCACTGGTCTGACC[T/G]
CTGCTGTACCGCCGGTCTGACCGGTGTATCTATACACGTAGTAGGAATCCGTTACAAATTATGGAAAATATCTCTACGAGTTAAGTGATTTCCAAAGTCC

Reverse complement sequence

GGACTTTGGAAATCACTTAACTCGTAGAGATATTTTCCATAATTTGTAACGGATTCCTACTACGTGTATAGATACACCGGTCAGACCGGCGGTACAGCAG[A/C]
GGTCAGACCAGTGGTATAACTATTTTGGAGTATAGACTCGGGAACATCAGATCCCGTACGATACAATATAAACTTTATCCCCTTCAAGTAGGACTTTGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.80%	19.60%	0.55%	0.00%	NA
All Indica	2759	93.30%	6.00%	0.65%	0.00%	NA
All Japonica	1512	51.30%	48.30%	0.40%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	82.40%	17.30%	0.34%	0.00%	NA
Indica II	465	94.40%	3.20%	2.37%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	3.60%	0.64%	0.00%	NA
Temperate Japonica	767	16.70%	82.70%	0.65%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	68.50%	31.10%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414540932	T -> G	LOC_Os04g25160.1	downstream_gene_variant ; 2745.0bp to feature; MODIFIER	silent_mutation	Average:43.269; most accessible tissue: Callus, score: 53.346	N	N	N	N
vg0414540932	T -> G	LOC_Os04g25150-LOC_Os04g25160	intergenic_region ; MODIFIER	silent_mutation	Average:43.269; most accessible tissue: Callus, score: 53.346	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414540932	NA	1.21E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	3.85E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	2.12E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	8.54E-15	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	1.58E-14	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	3.65E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	2.57E-09	mr1837	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	4.65E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414540932	NA	2.00E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251