\
| Variant ID: vg0414518378 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14518378 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 96. )
AAGAAGTTTGACTTAAAAAAGTCAAACGATTTGGGCTGCGTTTGATTCTACAACAAGAGTTGGATTAAATTTTGAATATTCATGGCACGCTTTTTAAGCT[A/G]
CTAAACGGTGCGTTTCGTGCAAAAACTTTCTATAAGAAAGTTGCTCTAAAATATTATATTAATCTATTTTTTAAGTTTGTAATAATTAAAATTTAATTAA
TTAATTAAATTTTAATTATTACAAACTTAAAAAATAGATTAATATAATATTTTAGAGCAACTTTCTTATAGAAAGTTTTTGCACGAAACGCACCGTTTAG[T/C]
AGCTTAAAAAGCGTGCCATGAATATTCAAAATTTAATCCAACTCTTGTTGTAGAATCAAACGCAGCCCAAATCGTTTGACTTTTTTAAGTCAAACTTCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.50% | 12.10% | 1.54% | 21.86% | NA |
| All Indica | 2759 | 54.90% | 11.10% | 2.32% | 31.71% | NA |
| All Japonica | 1512 | 91.30% | 0.30% | 0.13% | 8.27% | NA |
| Aus | 269 | 3.00% | 92.20% | 1.86% | 2.97% | NA |
| Indica I | 595 | 57.00% | 0.20% | 0.34% | 42.52% | NA |
| Indica II | 465 | 24.10% | 23.00% | 1.72% | 51.18% | NA |
| Indica III | 913 | 76.20% | 11.10% | 3.61% | 9.09% | NA |
| Indica Intermediate | 786 | 46.70% | 12.30% | 2.67% | 38.30% | NA |
| Temperate Japonica | 767 | 91.50% | 0.00% | 0.00% | 8.47% | NA |
| Tropical Japonica | 504 | 92.50% | 0.40% | 0.20% | 6.94% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.80% | 0.41% | 10.37% | NA |
| VI/Aromatic | 96 | 84.40% | 7.30% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 70.00% | 8.90% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414518378 | A -> DEL | N | N | silent_mutation | Average:8.297; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0414518378 | A -> G | LOC_Os04g25130.1 | upstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:8.297; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0414518378 | A -> G | LOC_Os04g25130-LOC_Os04g25140 | intergenic_region ; MODIFIER | silent_mutation | Average:8.297; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414518378 | NA | 5.52E-09 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | 6.42E-06 | NA | mr1143 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 4.15E-10 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 5.61E-09 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 1.73E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 1.38E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | 4.99E-06 | NA | mr1675 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 6.66E-10 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 3.23E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 6.03E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | 8.96E-06 | NA | mr1969 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 1.93E-09 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 1.42E-09 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 2.09E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 2.87E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414518378 | NA | 3.08E-17 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |