\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414510575:

Variant ID: vg0414510575 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14510575
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAAAAGAAGAGGAAACAAGACAATCAAACACCGAATGAAATATCCGAATGTATGAACTCTCTACATCATCCTTAATTTTTTACTTATATTCTATGTTT[A/G]
TGTGTTACTGATTTGACTTACCCTTTTCTAGTGTACATCGAGAAGGAAGATCTTACCCAAAAAAACATAGACAAAGGCCCACCAAAGAACGCCTTACGAG

Reverse complement sequence

CTCGTAAGGCGTTCTTTGGTGGGCCTTTGTCTATGTTTTTTTGGGTAAGATCTTCCTTCTCGATGTACACTAGAAAAGGGTAAGTCAAATCAGTAACACA[T/C]
AAACATAGAATATAAGTAAAAAATTAAGGATGATGTAGAGAGTTCATACATTCGGATATTTCATTCGGTGTTTGATTGTCTTGTTTCCTCTTCTTTTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 35.30% 6.07% 9.08% NA
All Indica  2759 80.40% 8.50% 4.02% 7.07% NA
All Japonica  1512 2.40% 85.00% 3.90% 8.66% NA
Aus  269 17.10% 29.00% 24.54% 29.37% NA
Indica I  595 82.20% 14.10% 3.19% 0.50% NA
Indica II  465 87.30% 6.70% 2.15% 3.87% NA
Indica III  913 75.40% 7.30% 5.26% 12.05% NA
Indica Intermediate  786 80.80% 6.70% 4.33% 8.14% NA
Temperate Japonica  767 1.80% 95.80% 0.65% 1.69% NA
Tropical Japonica  504 2.60% 71.00% 8.13% 18.25% NA
Japonica Intermediate  241 4.10% 79.70% 5.39% 10.79% NA
VI/Aromatic  96 11.50% 31.20% 40.62% 16.67% NA
Intermediate  90 34.40% 43.30% 13.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414510575 A -> DEL N N silent_mutation Average:17.409; most accessible tissue: Callus, score: 29.459 N N N N
vg0414510575 A -> G LOC_Os04g25130.1 downstream_gene_variant ; 1514.0bp to feature; MODIFIER silent_mutation Average:17.409; most accessible tissue: Callus, score: 29.459 N N N N
vg0414510575 A -> G LOC_Os04g25120.1 intron_variant ; MODIFIER silent_mutation Average:17.409; most accessible tissue: Callus, score: 29.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414510575 NA 2.66E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.08E-15 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 3.73E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.15E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.07E-23 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 7.02E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 8.83E-06 NA mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 6.72E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 1.19E-06 4.71E-12 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 2.05E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.08E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.20E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 2.35E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 5.01E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.31E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 5.56E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.68E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 7.51E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 6.31E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 3.60E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.57E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 9.73E-12 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 2.28E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 NA 1.10E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510575 8.31E-06 NA mr1972 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251