\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414484644:

Variant ID: vg0414484644 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14484644
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGATCTATAAACTTTAGCTGTATAGAAATACTATATATAGAAAATATTTGAATTCAAATTTATATAATTCAAATTCAAATTTGAAACGGGTATATAAA[C/T]
TTTAGGTGTATAAACTTTAGATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAATTCAAATTTGAATCTACTTTTGGTCTCTCAACTTTAGAT

Reverse complement sequence

ATCTAAAGTTGAGAGACCAAAAGTAGATTCAAATTTGAATTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATCTAAAGTTTATACACCTAAA[G/A]
TTTATATACCCGTTTCAAATTTGAATTTGAATTATATAAATTTGAATTCAAATATTTTCTATATATAGTATTTCTATACAGCTAAAGTTTATAGATCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.00% 8.50% 6.62% 63.88% NA
All Indica  2759 7.70% 0.70% 8.08% 83.58% NA
All Japonica  1512 48.90% 24.90% 3.90% 22.29% NA
Aus  269 0.40% 0.00% 0.00% 99.63% NA
Indica I  595 18.50% 0.20% 1.01% 80.34% NA
Indica II  465 8.20% 2.20% 1.72% 87.96% NA
Indica III  913 3.10% 0.20% 17.63% 79.08% NA
Indica Intermediate  786 4.60% 0.60% 6.11% 88.68% NA
Temperate Japonica  767 83.80% 2.20% 1.83% 12.13% NA
Tropical Japonica  504 5.40% 63.70% 5.16% 25.79% NA
Japonica Intermediate  241 29.00% 15.80% 7.88% 47.30% NA
VI/Aromatic  96 7.30% 0.00% 27.08% 65.62% NA
Intermediate  90 34.40% 10.00% 5.56% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414484644 C -> DEL N N silent_mutation Average:8.246; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0414484644 C -> T LOC_Os04g25080-LOC_Os04g25100 intergenic_region ; MODIFIER silent_mutation Average:8.246; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414484644 NA 1.82E-18 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 2.65E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 5.82E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 4.25E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 7.35E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 9.52E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 6.50E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 8.55E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 1.20E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 7.20E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 3.95E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 4.77E-10 mr1786_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414484644 NA 8.92E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251