| Variant ID: vg0414466419 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14466419 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTTCGCCATCGCCGCTCGCCCTCCCGGCATGCCCGCCGTGCCCCCTAGCTGATGAGAGAGAGAAGAGAGAGAGGGGTGAGGTAGGAGTACATGACAAGT[G/A,T]
GGCCCACAGTTTTTTAATATTTTTTTTATTGGATTGCCACGTGGCGCCATGTATGTGCCACGTAGGAGCAAAACCACTCTGTGTTGAGCCAAGGGGGTAA
TTACCCCCTTGGCTCAACACAGAGTGGTTTTGCTCCTACGTGGCACATACATGGCGCCACGTGGCAATCCAATAAAAAAAATATTAAAAAACTGTGGGCC[C/T,A]
ACTTGTCATGTACTCCTACCTCACCCCTCTCTCTCTTCTCTCTCTCATCAGCTAGGGGGCACGGCGGGCATGCCGGGAGGGCGAGCGGCGATGGCGAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 2.10% | 5.14% | 28.86% | T: 0.53% |
| All Indica | 2759 | 55.00% | 3.20% | 6.20% | 34.76% | T: 0.83% |
| All Japonica | 1512 | 74.70% | 0.50% | 3.84% | 20.90% | T: 0.07% |
| Aus | 269 | 98.10% | 0.40% | 0.00% | 1.49% | NA |
| Indica I | 595 | 52.40% | 0.70% | 3.53% | 43.36% | NA |
| Indica II | 465 | 85.20% | 0.90% | 1.72% | 8.60% | T: 3.66% |
| Indica III | 913 | 38.90% | 6.60% | 12.27% | 42.17% | T: 0.11% |
| Indica Intermediate | 786 | 57.90% | 2.50% | 3.82% | 35.11% | T: 0.64% |
| Temperate Japonica | 767 | 87.90% | 0.00% | 0.78% | 11.34% | NA |
| Tropical Japonica | 504 | 65.50% | 1.00% | 7.14% | 26.39% | NA |
| Japonica Intermediate | 241 | 51.90% | 1.20% | 6.64% | 39.83% | T: 0.41% |
| VI/Aromatic | 96 | 14.60% | 2.10% | 12.50% | 70.83% | NA |
| Intermediate | 90 | 76.70% | 1.10% | 2.22% | 18.89% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414466419 | G -> DEL | N | N | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| vg0414466419 | G -> A | LOC_Os04g25070.1 | upstream_gene_variant ; 4551.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| vg0414466419 | G -> A | LOC_Os04g25080.1 | upstream_gene_variant ; 1456.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| vg0414466419 | G -> A | LOC_Os04g25070-LOC_Os04g25080 | intergenic_region ; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| vg0414466419 | G -> T | LOC_Os04g25070.1 | upstream_gene_variant ; 4551.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| vg0414466419 | G -> T | LOC_Os04g25080.1 | upstream_gene_variant ; 1456.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| vg0414466419 | G -> T | LOC_Os04g25070-LOC_Os04g25080 | intergenic_region ; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Callus, score: 70.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414466419 | NA | 8.55E-07 | mr1010 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 5.31E-08 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 3.52E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 9.83E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 8.80E-06 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | 6.83E-06 | 6.81E-06 | mr1651_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 2.74E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 4.06E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 1.99E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414466419 | NA | 2.68E-06 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |