\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414404728:

Variant ID: vg0414404728 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14404728
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGTTAAATGTGTAAAGGAATACTTTGAATGCTAAATGATGACAACATGAAGAGAAGATTCCATCTGCAACAGTGGATCGAGCCAAGCAGTCCAGAGTG[A/G]
AGAAGTTTTGTTAGGCAAGTTTGTTATAGAAGACGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAAT

Reverse complement sequence

ATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGTCTTCTATAACAAACTTGCCTAACAAAACTTCT[T/C]
CACTCTGGACTGCTTGGCTCGATCCACTGTTGCAGATGGAATCTTCTCTTCATGTTGTCATCATTTAGCATTCAAAGTATTCCTTTACACATTTAACCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.80% 22.30% 46.70% 3.15% NA
All Indica  2759 15.00% 20.40% 60.53% 4.10% NA
All Japonica  1512 55.20% 24.30% 18.32% 2.18% NA
Aus  269 7.10% 19.70% 73.23% 0.00% NA
Indica I  595 22.40% 19.50% 56.30% 1.85% NA
Indica II  465 10.80% 13.80% 73.55% 1.94% NA
Indica III  913 11.90% 23.30% 56.41% 8.32% NA
Indica Intermediate  786 15.40% 21.60% 60.81% 2.16% NA
Temperate Japonica  767 83.70% 4.70% 8.87% 2.74% NA
Tropical Japonica  504 23.80% 44.60% 30.16% 1.39% NA
Japonica Intermediate  241 29.90% 44.40% 23.65% 2.07% NA
VI/Aromatic  96 15.60% 56.20% 27.08% 1.04% NA
Intermediate  90 36.70% 20.00% 41.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414404728 A -> DEL N N silent_mutation Average:82.896; most accessible tissue: Zhenshan97 young leaf, score: 96.628 N N N N
vg0414404728 A -> G LOC_Os04g25010.1 upstream_gene_variant ; 3359.0bp to feature; MODIFIER silent_mutation Average:82.896; most accessible tissue: Zhenshan97 young leaf, score: 96.628 N N N N
vg0414404728 A -> G LOC_Os04g24998.1 downstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:82.896; most accessible tissue: Zhenshan97 young leaf, score: 96.628 N N N N
vg0414404728 A -> G LOC_Os04g24998-LOC_Os04g25010 intergenic_region ; MODIFIER silent_mutation Average:82.896; most accessible tissue: Zhenshan97 young leaf, score: 96.628 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0414404728 A G 0.03 0.02 0.03 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414404728 NA 2.40E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 1.20E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 2.48E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 6.66E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 1.08E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 6.56E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 3.95E-08 NA mr1627 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 2.87E-11 mr1627 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 2.73E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 2.54E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 1.53E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 2.69E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 4.12E-08 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 2.84E-06 mr1906 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 4.68E-10 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 5.25E-08 mr1977 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 1.16E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 5.20E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 3.92E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414404728 NA 1.46E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251