\
| Variant ID: vg0414371844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14371844 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 81. )
AGGGTAGCACTAGCTGCTGCATTGTTTACAACATAGCCAGACCTAGAAAGCCAACAGTACTAGAAAATGGTTTTTTTTAACTGTCAACGTTTTTTTATGG[C/A]
TAGGAAATTGCTTTCACTGAAAATGAACCTTTTGACATCTGGGAGCAATGCTTCACGAAAACTGCTCTTTTCGTGGAAGGAAGGATATTCCAGAAGTGAA
TTCACTTCTGGAATATCCTTCCTTCCACGAAAAGAGCAGTTTTCGTGAAGCATTGCTCCCAGATGTCAAAAGGTTCATTTTCAGTGAAAGCAATTTCCTA[G/T]
CCATAAAAAAACGTTGACAGTTAAAAAAAACCATTTTCTAGTACTGTTGGCTTTCTAGGTCTGGCTATGTTGTAAACAATGCAGCAGCTAGTGCTACCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 21.80% | 0.19% | 5.14% | NA |
| All Indica | 2759 | 87.80% | 7.90% | 0.14% | 4.20% | NA |
| All Japonica | 1512 | 41.50% | 50.90% | 0.26% | 7.34% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.30% | 15.10% | 0.50% | 13.11% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 92.90% | 5.80% | 0.00% | 1.31% | NA |
| Indica Intermediate | 786 | 89.70% | 7.00% | 0.13% | 3.18% | NA |
| Temperate Japonica | 767 | 6.90% | 84.70% | 0.52% | 7.82% | NA |
| Tropical Japonica | 504 | 86.50% | 6.30% | 0.00% | 7.14% | NA |
| Japonica Intermediate | 241 | 57.30% | 36.50% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 76.00% | 12.50% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 63.30% | 30.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414371844 | C -> DEL | N | N | silent_mutation | Average:20.238; most accessible tissue: Callus, score: 42.552 | N | N | N | N |
| vg0414371844 | C -> A | LOC_Os04g24950.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.238; most accessible tissue: Callus, score: 42.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414371844 | NA | 3.86E-07 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | NA | 1.63E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | NA | 2.38E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | NA | 2.41E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | NA | 1.48E-07 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | 3.39E-07 | 3.39E-07 | mr1621 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | 7.11E-06 | 7.11E-06 | mr1701 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414371844 | 7.37E-06 | 7.37E-06 | mr1779 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |