Variant ID: vg0414370101 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 14370101 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 191. )
TTCAGAGGAGGGATCAACAACATGTCGATATAGTGACACAATCGATCAGAAAAGTACCGGGTACAGTCTACAAGAGCTGCTCTATGCTGTGAACTACCCA[T/C]
GTCTAGTTTGGTAGAGCATCTCCAGTGTGGGGCTAGCATCGATTTTAGAGGAAAGAAACCGAACAATGCACATTGTTAGAATCGATTAGATTGTGTTCGG
CCGAACACAATCTAATCGATTCTAACAATGTGCATTGTTCGGTTTCTTTCCTCTAAAATCGATGCTAGCCCCACACTGGAGATGCTCTACCAAACTAGAC[A/G]
TGGGTAGTTCACAGCATAGAGCAGCTCTTGTAGACTGTACCCGGTACTTTTCTGATCGATTGTGTCACTATATCGACATGTTGTTGATCCCTCCTCTGAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 72.70% | 20.90% | 1.42% | 5.04% | NA |
All Indica | 2759 | 87.60% | 6.20% | 1.96% | 4.28% | NA |
All Japonica | 1512 | 41.30% | 50.90% | 0.53% | 7.28% | NA |
Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 70.80% | 15.30% | 0.84% | 13.11% | NA |
Indica II | 465 | 95.50% | 3.70% | 0.43% | 0.43% | NA |
Indica III | 913 | 92.80% | 2.50% | 3.40% | 1.31% | NA |
Indica Intermediate | 786 | 89.60% | 5.10% | 2.04% | 3.31% | NA |
Temperate Japonica | 767 | 6.80% | 84.70% | 0.65% | 7.82% | NA |
Tropical Japonica | 504 | 86.50% | 6.00% | 0.40% | 7.14% | NA |
Japonica Intermediate | 241 | 56.80% | 36.90% | 0.41% | 5.81% | NA |
VI/Aromatic | 96 | 76.00% | 14.60% | 4.17% | 5.21% | NA |
Intermediate | 90 | 60.00% | 33.30% | 1.11% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0414370101 | T -> C | LOC_Os04g24940.1 | downstream_gene_variant ; 3592.0bp to feature; MODIFIER | silent_mutation | Average:15.398; most accessible tissue: Callus, score: 38.711 | N | N | N | N |
vg0414370101 | T -> C | LOC_Os04g24950.1 | downstream_gene_variant ; 621.0bp to feature; MODIFIER | silent_mutation | Average:15.398; most accessible tissue: Callus, score: 38.711 | N | N | N | N |
vg0414370101 | T -> C | LOC_Os04g24940-LOC_Os04g24950 | intergenic_region ; MODIFIER | silent_mutation | Average:15.398; most accessible tissue: Callus, score: 38.711 | N | N | N | N |
vg0414370101 | T -> DEL | N | N | silent_mutation | Average:15.398; most accessible tissue: Callus, score: 38.711 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0414370101 | NA | 2.21E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0414370101 | NA | 1.27E-06 | mr1403 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0414370101 | NA | 7.19E-10 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0414370101 | NA | 1.65E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0414370101 | NA | 5.88E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0414370101 | NA | 9.08E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |