Search for Variation information by Variation ID:
Detailed information for vg0414335944:
| Variant ID: vg0414335944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14335944 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AACTCCTTGGTTGATGCCGTTGTCGATGAAGTTTGACGGTATAGTAGTAGAACCTTGAGCACCAAGGCCCCCTACCTGGTGCGCCACTGTCGACGGGGGA[A/T]
ACCCGCAGACCGGATATAGAGGGTATTGGGGTACGCTGGTATGAGTATCTACGTAGTACGACATCAAGCAAACAAAAAACAGTGATTATACTAGTTCAGG
Reverse complement sequence
CCTGAACTAGTATAATCACTGTTTTTTGTTTGCTTGATGTCGTACTACGTAGATACTCATACCAGCGTACCCCAATACCCTCTATATCCGGTCTGCGGGT[T/A]
TCCCCCGTCGACAGTGGCGCACCAGGTAGGGGGCCTTGGTGCTCAAGGTTCTACTACTATACCGTCAAACTTCATCGACAACGGCATCAACCAAGGAGTT
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 16.00% | 2.12% | 19.51% | NA |
| All Indica | 2759 | 53.00% | 16.50% | 3.41% | 27.08% | NA |
| All Japonica | 1512 | 90.00% | 0.20% | 0.33% | 9.46% | NA |
| Aus | 269 | 4.80% | 94.80% | 0.00% | 0.37% | NA |
| Indica I | 595 | 61.80% | 0.20% | 4.37% | 33.61% | NA |
| Indica II | 465 | 24.10% | 30.50% | 5.38% | 40.00% | NA |
| Indica III | 913 | 65.70% | 21.50% | 0.88% | 11.94% | NA |
| Indica Intermediate | 786 | 48.60% | 14.90% | 4.45% | 32.06% | NA |
| Temperate Japonica | 767 | 91.70% | 0.00% | 0.00% | 8.34% | NA |
| Tropical Japonica | 504 | 90.70% | 0.20% | 0.79% | 8.33% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.80% | 0.41% | 15.35% | NA |
| VI/Aromatic | 96 | 55.20% | 33.30% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 65.60% | 11.10% | 1.11% | 22.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414335944 | A -> DEL | LOC_Os04g24880.1 | N | frameshift_variant | Average:8.692; most accessible tissue: Callus, score: 30.739 | N | N | N | N |
| vg0414335944 | A -> T | LOC_Os04g24880.1 | missense_variant ; p.Phe22Tyr; MODERATE | nonsynonymous_codon ; F22Y | Average:8.692; most accessible tissue: Callus, score: 30.739 | benign  |
-1.397 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414335944 | NA | 5.33E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 9.57E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 1.44E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 8.32E-08 | mr1749 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 1.42E-07 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 8.46E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 8.06E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414335944 | NA | 8.06E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |