\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414329245:

Variant ID: vg0414329245 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14329245
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, A: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGAGAAGGGGAGGAAGTTCTCCTCCATGCTCGGCAATCATCGGAAGGCGCCCACTCCATCGGTGAGCCCCTTTGGTCATTTATTGCGTAGTCGGAAGA[T/C]
GTTGTCCTCACACCGTACTCGTTTTACTTAGGCATCGGATGCGTCTCCCCCGCCTCCGCGACGGCAGAGGCTGGTGACACTTGGTGAGAAGTAAGTGGAC

Reverse complement sequence

GTCCACTTACTTCTCACCAAGTGTCACCAGCCTCTGCCGTCGCGGAGGCGGGGGAGACGCATCCGATGCCTAAGTAAAACGAGTACGGTGTGAGGACAAC[A/G]
TCTTCCGACTACGCAATAAATGACCAAAGGGGCTCACCGATGGAGTGGGCGCCTTCCGATGATTGCCGAGCATGGAGGAGAACTTCCTCCCCTTCTCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 26.50% 5.67% 5.99% NA
All Indica  2759 51.60% 33.50% 8.16% 6.71% NA
All Japonica  1512 90.90% 0.70% 2.25% 6.08% NA
Aus  269 4.10% 95.50% 0.37% 0.00% NA
Indica I  595 58.80% 22.90% 12.44% 5.88% NA
Indica II  465 23.00% 51.40% 12.47% 13.12% NA
Indica III  913 66.30% 29.40% 2.41% 1.97% NA
Indica Intermediate  786 46.20% 35.80% 9.03% 9.03% NA
Temperate Japonica  767 92.00% 0.10% 1.04% 6.78% NA
Tropical Japonica  504 92.30% 1.00% 4.56% 2.18% NA
Japonica Intermediate  241 84.60% 2.10% 1.24% 12.03% NA
VI/Aromatic  96 54.20% 44.80% 1.04% 0.00% NA
Intermediate  90 65.60% 20.00% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414329245 T -> C LOC_Os04g24860.1 upstream_gene_variant ; 146.0bp to feature; MODIFIER silent_mutation Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0414329245 T -> C LOC_Os04g24870.1 downstream_gene_variant ; 2464.0bp to feature; MODIFIER silent_mutation Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0414329245 T -> C LOC_Os04g24880.1 downstream_gene_variant ; 4034.0bp to feature; MODIFIER silent_mutation Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0414329245 T -> C LOC_Os04g24850-LOC_Os04g24860 intergenic_region ; MODIFIER silent_mutation Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0414329245 T -> DEL N N silent_mutation Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414329245 NA 1.17E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245 NA 6.63E-06 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245 NA 5.57E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245 NA 1.80E-07 mr1946_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245 NA 1.80E-07 mr1948_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251