Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414329245:

Variant ID: vg0414329245 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14329245
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, A: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGAGAAGGGGAGGAAGTTCTCCTCCATGCTCGGCAATCATCGGAAGGCGCCCACTCCATCGGTGAGCCCCTTTGGTCATTTATTGCGTAGTCGGAAGA[T/C]
GTTGTCCTCACACCGTACTCGTTTTACTTAGGCATCGGATGCGTCTCCCCCGCCTCCGCGACGGCAGAGGCTGGTGACACTTGGTGAGAAGTAAGTGGAC

Reverse complement sequence

GTCCACTTACTTCTCACCAAGTGTCACCAGCCTCTGCCGTCGCGGAGGCGGGGGAGACGCATCCGATGCCTAAGTAAAACGAGTACGGTGTGAGGACAAC[A/G]
TCTTCCGACTACGCAATAAATGACCAAAGGGGCTCACCGATGGAGTGGGCGCCTTCCGATGATTGCCGAGCATGGAGGAGAACTTCCTCCCCTTCTCCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	26.50%	5.67%	5.99%	NA
All Indica	2759	51.60%	33.50%	8.16%	6.71%	NA
All Japonica	1512	90.90%	0.70%	2.25%	6.08%	NA
Aus	269	4.10%	95.50%	0.37%	0.00%	NA
Indica I	595	58.80%	22.90%	12.44%	5.88%	NA
Indica II	465	23.00%	51.40%	12.47%	13.12%	NA
Indica III	913	66.30%	29.40%	2.41%	1.97%	NA
Indica Intermediate	786	46.20%	35.80%	9.03%	9.03%	NA
Temperate Japonica	767	92.00%	0.10%	1.04%	6.78%	NA
Tropical Japonica	504	92.30%	1.00%	4.56%	2.18%	NA
Japonica Intermediate	241	84.60%	2.10%	1.24%	12.03%	NA
VI/Aromatic	96	54.20%	44.80%	1.04%	0.00%	NA
Intermediate	90	65.60%	20.00%	7.78%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414329245	T -> C	LOC_Os04g24860.1	upstream_gene_variant ; 146.0bp to feature; MODIFIER	silent_mutation	Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0414329245	T -> C	LOC_Os04g24870.1	downstream_gene_variant ; 2464.0bp to feature; MODIFIER	silent_mutation	Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0414329245	T -> C	LOC_Os04g24880.1	downstream_gene_variant ; 4034.0bp to feature; MODIFIER	silent_mutation	Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0414329245	T -> C	LOC_Os04g24850-LOC_Os04g24860	intergenic_region ; MODIFIER	silent_mutation	Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N
vg0414329245	T -> DEL	N	N	silent_mutation	Average:13.573; most accessible tissue: Zhenshan97 root, score: 34.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414329245	NA	1.17E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245	NA	6.63E-06	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245	NA	5.57E-06	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245	NA	1.80E-07	mr1946_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414329245	NA	1.80E-07	mr1948_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251