\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414249582:

Variant ID: vg0414249582 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14249582
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGGTAAATTTCAGCATTTAGGAGAATAAACACAAGTCTATACTCAATAGATATCCACACGCCGCTCATGACCGCGAGCACAACGAATCGATTAGTTTT[A/G,T]
ACTCTGCAGAGTTTGTACACTTTACCCACATGATGCGAAATAATAATCATGCAAGAGCATGGCACGCGATACATAAGTACCCGATTTATTACCCGCAACA

Reverse complement sequence

TGTTGCGGGTAATAAATCGGGTACTTATGTATCGCGTGCCATGCTCTTGCATGATTATTATTTCGCATCATGTGGGTAAAGTGTACAAACTCTGCAGAGT[T/C,A]
AAAACTAATCGATTCGTTGTGCTCGCGGTCATGAGCGGCGTGTGGATATCTATTGAGTATAGACTTGTGTTTATTCTCCTAAATGCTGAAATTTACCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 0.40% 1.38% 32.44% G: 0.04%
All Indica  2759 63.40% 0.20% 0.80% 35.56% G: 0.04%
All Japonica  1512 71.40% 0.50% 0.86% 27.25% NA
Aus  269 62.50% 0.40% 2.23% 34.57% G: 0.37%
Indica I  595 62.90% 0.00% 0.17% 36.97% NA
Indica II  465 71.80% 0.00% 0.65% 27.53% NA
Indica III  913 63.90% 0.00% 1.42% 34.72% NA
Indica Intermediate  786 58.40% 0.60% 0.64% 40.20% G: 0.13%
Temperate Japonica  767 93.90% 0.30% 0.39% 5.48% NA
Tropical Japonica  504 49.00% 0.20% 0.99% 49.80% NA
Japonica Intermediate  241 46.50% 2.10% 2.07% 49.38% NA
VI/Aromatic  96 56.20% 5.20% 23.96% 14.58% NA
Intermediate  90 61.10% 1.10% 1.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414249582 A -> DEL N N silent_mutation Average:5.177; most accessible tissue: Callus, score: 9.311 N N N N
vg0414249582 A -> G LOC_Os04g24804.1 intron_variant ; MODIFIER silent_mutation Average:5.177; most accessible tissue: Callus, score: 9.311 N N N N
vg0414249582 A -> T LOC_Os04g24804.1 intron_variant ; MODIFIER silent_mutation Average:5.177; most accessible tissue: Callus, score: 9.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414249582 NA 5.46E-06 mr1964 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 6.01E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 2.06E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 5.10E-06 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 1.20E-06 1.20E-06 mr1146_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 8.04E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 3.74E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 4.17E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 1.20E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 2.65E-06 1.58E-06 mr1482_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 8.68E-06 2.16E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 1.12E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 5.51E-06 5.51E-06 mr1597_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 1.72E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 1.60E-06 mr1736_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 2.55E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 1.87E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 8.28E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 4.45E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 5.12E-08 7.00E-06 mr1849_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 3.13E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249582 NA 1.81E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251