\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414249163:

Variant ID: vg0414249163 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14249163
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTGTCTACCCAATCCACAAGCACACCGACTAGGGGTTTACCCCATTAAGTTCAAGTACTAGAAGAAGCAGTCGATTACCCGCATCACTCAAAGACTAA[G/A]
TCTAAAACCTGCAAGCAAAAGATTAATTCAATAGCAAGAGTCAGTACATTATTAGGGCAAGCACCAAGACAAGCCTAACACCCTACTTGCAAGGCATATA

Reverse complement sequence

TATATGCCTTGCAAGTAGGGTGTTAGGCTTGTCTTGGTGCTTGCCCTAATAATGTACTGACTCTTGCTATTGAATTAATCTTTTGCTTGCAGGTTTTAGA[C/T]
TTAGTCTTTGAGTGATGCGGGTAATCGACTGCTTCTTCTAGTACTTGAACTTAATGGGGTAAACCCCTAGTCGGTGTGCTTGTGGATTGGGTAGACAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 0.20% 9.31% 36.31% NA
All Indica  2759 49.30% 0.00% 12.07% 38.60% NA
All Japonica  1512 64.80% 0.40% 4.03% 30.75% NA
Aus  269 35.70% 0.00% 12.27% 52.04% NA
Indica I  595 52.80% 0.00% 10.42% 36.81% NA
Indica II  465 60.40% 0.20% 10.32% 29.03% NA
Indica III  913 42.90% 0.00% 14.68% 42.39% NA
Indica Intermediate  786 47.50% 0.00% 11.32% 41.22% NA
Temperate Japonica  767 93.90% 0.00% 0.39% 5.74% NA
Tropical Japonica  504 28.60% 1.20% 9.72% 60.52% NA
Japonica Intermediate  241 48.10% 0.00% 3.73% 48.13% NA
VI/Aromatic  96 83.30% 1.00% 3.12% 12.50% NA
Intermediate  90 50.00% 1.10% 11.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414249163 G -> DEL N N silent_mutation Average:9.507; most accessible tissue: Callus, score: 26.932 N N N N
vg0414249163 G -> A LOC_Os04g24804.1 3_prime_UTR_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:9.507; most accessible tissue: Callus, score: 26.932 N N N N
vg0414249163 G -> A LOC_Os04g24800.1 downstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:9.507; most accessible tissue: Callus, score: 26.932 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414249163 NA 1.76E-06 mr1964 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 1.27E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 2.50E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 2.25E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 1.01E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 5.09E-07 5.09E-07 mr1147_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 1.18E-07 6.49E-10 mr1194_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 1.37E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 3.23E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 1.02E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 2.42E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 5.24E-06 4.47E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 2.96E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 4.15E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 5.88E-07 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 1.23E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 5.38E-07 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 9.23E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 NA 9.05E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414249163 2.49E-06 NA mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251