\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414241409:

Variant ID: vg0414241409 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14241409
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, A: 0.39, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATTACCTAGGAATGAAATAATCCCCAACACACTTAATCCTTGAATTCCATGCTGCTTGGGCCATATTATATTGATTCCTTCCAATTAGCATTCTCC[A/T]
TTGTCTTCTCTGTTTTTATTTTTTAAAAAATAGATCTCATATACCGGGCAAAGTTTTTTATTTTCCGGATGTACCATGGATAGTCAATATGCCTTGGTTA

Reverse complement sequence

TAACCAAGGCATATTGACTATCCATGGTACATCCGGAAAATAAAAAACTTTGCCCGGTATATGAGATCTATTTTTTAAAAAATAAAAACAGAGAAGACAA[T/A]
GGAGAATGCTAATTGGAAGGAATCAATATAATATGGCCCAAGCAGCATGGAATTCAAGGATTAAGTGTGTTGGGGATTATTTCATTCCTAGGTAATATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.20% 24.50% 3.28% 39.95% NA
All Indica  2759 45.70% 11.60% 3.84% 38.93% NA
All Japonica  1512 0.70% 53.40% 0.20% 45.63% NA
Aus  269 71.40% 0.70% 14.13% 13.75% NA
Indica I  595 24.70% 35.60% 4.20% 35.46% NA
Indica II  465 75.70% 4.10% 5.59% 14.62% NA
Indica III  913 41.40% 2.40% 1.86% 54.33% NA
Indica Intermediate  786 48.70% 8.40% 4.83% 38.04% NA
Temperate Japonica  767 0.30% 92.20% 0.00% 7.56% NA
Tropical Japonica  504 0.60% 4.60% 0.60% 94.25% NA
Japonica Intermediate  241 2.50% 32.40% 0.00% 65.15% NA
VI/Aromatic  96 31.20% 9.40% 4.17% 55.21% NA
Intermediate  90 33.30% 24.40% 4.44% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414241409 A -> DEL N N silent_mutation Average:6.612; most accessible tissue: Callus, score: 16.706 N N N N
vg0414241409 A -> T LOC_Os04g24800.1 upstream_gene_variant ; 2226.0bp to feature; MODIFIER silent_mutation Average:6.612; most accessible tissue: Callus, score: 16.706 N N N N
vg0414241409 A -> T LOC_Os04g24780.1 downstream_gene_variant ; 4272.0bp to feature; MODIFIER silent_mutation Average:6.612; most accessible tissue: Callus, score: 16.706 N N N N
vg0414241409 A -> T LOC_Os04g24790.1 downstream_gene_variant ; 1114.0bp to feature; MODIFIER silent_mutation Average:6.612; most accessible tissue: Callus, score: 16.706 N N N N
vg0414241409 A -> T LOC_Os04g24790-LOC_Os04g24800 intergenic_region ; MODIFIER silent_mutation Average:6.612; most accessible tissue: Callus, score: 16.706 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414241409 NA 5.81E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 1.78E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 2.27E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 4.45E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 4.21E-22 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 1.50E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 2.12E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 4.71E-09 mr1944 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 2.83E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 1.64E-18 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414241409 NA 7.22E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251