\
| Variant ID: vg0414241409 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14241409 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, A: 0.39, others allele: 0.00, population size: 36. )
AAATATTACCTAGGAATGAAATAATCCCCAACACACTTAATCCTTGAATTCCATGCTGCTTGGGCCATATTATATTGATTCCTTCCAATTAGCATTCTCC[A/T]
TTGTCTTCTCTGTTTTTATTTTTTAAAAAATAGATCTCATATACCGGGCAAAGTTTTTTATTTTCCGGATGTACCATGGATAGTCAATATGCCTTGGTTA
TAACCAAGGCATATTGACTATCCATGGTACATCCGGAAAATAAAAAACTTTGCCCGGTATATGAGATCTATTTTTTAAAAAATAAAAACAGAGAAGACAA[T/A]
GGAGAATGCTAATTGGAAGGAATCAATATAATATGGCCCAAGCAGCATGGAATTCAAGGATTAAGTGTGTTGGGGATTATTTCATTCCTAGGTAATATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 24.50% | 3.28% | 39.95% | NA |
| All Indica | 2759 | 45.70% | 11.60% | 3.84% | 38.93% | NA |
| All Japonica | 1512 | 0.70% | 53.40% | 0.20% | 45.63% | NA |
| Aus | 269 | 71.40% | 0.70% | 14.13% | 13.75% | NA |
| Indica I | 595 | 24.70% | 35.60% | 4.20% | 35.46% | NA |
| Indica II | 465 | 75.70% | 4.10% | 5.59% | 14.62% | NA |
| Indica III | 913 | 41.40% | 2.40% | 1.86% | 54.33% | NA |
| Indica Intermediate | 786 | 48.70% | 8.40% | 4.83% | 38.04% | NA |
| Temperate Japonica | 767 | 0.30% | 92.20% | 0.00% | 7.56% | NA |
| Tropical Japonica | 504 | 0.60% | 4.60% | 0.60% | 94.25% | NA |
| Japonica Intermediate | 241 | 2.50% | 32.40% | 0.00% | 65.15% | NA |
| VI/Aromatic | 96 | 31.20% | 9.40% | 4.17% | 55.21% | NA |
| Intermediate | 90 | 33.30% | 24.40% | 4.44% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414241409 | A -> DEL | N | N | silent_mutation | Average:6.612; most accessible tissue: Callus, score: 16.706 | N | N | N | N |
| vg0414241409 | A -> T | LOC_Os04g24800.1 | upstream_gene_variant ; 2226.0bp to feature; MODIFIER | silent_mutation | Average:6.612; most accessible tissue: Callus, score: 16.706 | N | N | N | N |
| vg0414241409 | A -> T | LOC_Os04g24780.1 | downstream_gene_variant ; 4272.0bp to feature; MODIFIER | silent_mutation | Average:6.612; most accessible tissue: Callus, score: 16.706 | N | N | N | N |
| vg0414241409 | A -> T | LOC_Os04g24790.1 | downstream_gene_variant ; 1114.0bp to feature; MODIFIER | silent_mutation | Average:6.612; most accessible tissue: Callus, score: 16.706 | N | N | N | N |
| vg0414241409 | A -> T | LOC_Os04g24790-LOC_Os04g24800 | intergenic_region ; MODIFIER | silent_mutation | Average:6.612; most accessible tissue: Callus, score: 16.706 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414241409 | NA | 5.81E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 1.78E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 2.27E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 4.45E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 4.21E-22 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 1.50E-07 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 2.12E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 4.71E-09 | mr1944 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 2.83E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 1.64E-18 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414241409 | NA | 7.22E-08 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |