| Variant ID: vg0414235648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14235648 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.02, others allele: 0.00, population size: 49. )
TAGTCTTAGTACGCGTCTATTTTTATCATTTATCTTCTACTTGAGTTTGTTGCCTTGTGTGCTTTTTGGTATGGACTATATCGACCCGTTGTGATATAGC[T/C]
GTACCTTTGTGGTGCTTAAGCAACTTGAACTCTATGTAACCAACATCACATCAATAAAATTTAAATAAGTTGGTTTAATAGCTCGTGTTCTTGTCCTAAT
ATTAGGACAAGAACACGAGCTATTAAACCAACTTATTTAAATTTTATTGATGTGATGTTGGTTACATAGAGTTCAAGTTGCTTAAGCACCACAAAGGTAC[A/G]
GCTATATCACAACGGGTCGATATAGTCCATACCAAAAAGCACACAAGGCAACAAACTCAAGTAGAAGATAAATGATAAAAATAGACGCGTACTAAGACTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 30.80% | 2.37% | 17.37% | NA |
| All Indica | 2759 | 66.80% | 21.20% | 2.68% | 9.35% | NA |
| All Japonica | 1512 | 8.40% | 53.30% | 2.18% | 36.11% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 55.80% | 30.60% | 3.19% | 10.42% | NA |
| Indica II | 465 | 60.40% | 29.70% | 1.94% | 7.96% | NA |
| Indica III | 913 | 70.20% | 17.60% | 2.52% | 9.64% | NA |
| Indica Intermediate | 786 | 74.90% | 13.10% | 2.93% | 9.03% | NA |
| Temperate Japonica | 767 | 1.80% | 91.50% | 0.91% | 5.74% | NA |
| Tropical Japonica | 504 | 18.30% | 5.40% | 3.57% | 72.82% | NA |
| Japonica Intermediate | 241 | 8.70% | 32.00% | 3.32% | 56.02% | NA |
| VI/Aromatic | 96 | 60.40% | 35.40% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 50.00% | 31.10% | 2.22% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414235648 | T -> C | LOC_Os04g24790.1 | upstream_gene_variant ; 3989.0bp to feature; MODIFIER | silent_mutation | Average:22.9; most accessible tissue: Callus, score: 29.778 | N | N | N | N |
| vg0414235648 | T -> C | LOC_Os04g24780.1 | intron_variant ; MODIFIER | silent_mutation | Average:22.9; most accessible tissue: Callus, score: 29.778 | N | N | N | N |
| vg0414235648 | T -> DEL | N | N | silent_mutation | Average:22.9; most accessible tissue: Callus, score: 29.778 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414235648 | NA | 1.77E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 4.85E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 7.85E-08 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 5.85E-06 | mr1220 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 6.45E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 5.94E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 5.93E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 1.21E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 1.81E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414235648 | NA | 2.08E-08 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/