Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414235648:

Variant ID: vg0414235648 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14235648
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTCTTAGTACGCGTCTATTTTTATCATTTATCTTCTACTTGAGTTTGTTGCCTTGTGTGCTTTTTGGTATGGACTATATCGACCCGTTGTGATATAGC[T/C]
GTACCTTTGTGGTGCTTAAGCAACTTGAACTCTATGTAACCAACATCACATCAATAAAATTTAAATAAGTTGGTTTAATAGCTCGTGTTCTTGTCCTAAT

Reverse complement sequence

ATTAGGACAAGAACACGAGCTATTAAACCAACTTATTTAAATTTTATTGATGTGATGTTGGTTACATAGAGTTCAAGTTGCTTAAGCACCACAAAGGTAC[A/G]
GCTATATCACAACGGGTCGATATAGTCCATACCAAAAAGCACACAAGGCAACAAACTCAAGTAGAAGATAAATGATAAAAATAGACGCGTACTAAGACTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	30.80%	2.37%	17.37%	NA
All Indica	2759	66.80%	21.20%	2.68%	9.35%	NA
All Japonica	1512	8.40%	53.30%	2.18%	36.11%	NA
Aus	269	98.50%	1.10%	0.00%	0.37%	NA
Indica I	595	55.80%	30.60%	3.19%	10.42%	NA
Indica II	465	60.40%	29.70%	1.94%	7.96%	NA
Indica III	913	70.20%	17.60%	2.52%	9.64%	NA
Indica Intermediate	786	74.90%	13.10%	2.93%	9.03%	NA
Temperate Japonica	767	1.80%	91.50%	0.91%	5.74%	NA
Tropical Japonica	504	18.30%	5.40%	3.57%	72.82%	NA
Japonica Intermediate	241	8.70%	32.00%	3.32%	56.02%	NA
VI/Aromatic	96	60.40%	35.40%	3.12%	1.04%	NA
Intermediate	90	50.00%	31.10%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414235648	T -> C	LOC_Os04g24790.1	upstream_gene_variant ; 3989.0bp to feature; MODIFIER	silent_mutation	Average:22.9; most accessible tissue: Callus, score: 29.778	N	N	N	N
vg0414235648	T -> C	LOC_Os04g24780.1	intron_variant ; MODIFIER	silent_mutation	Average:22.9; most accessible tissue: Callus, score: 29.778	N	N	N	N
vg0414235648	T -> DEL	N	N	silent_mutation	Average:22.9; most accessible tissue: Callus, score: 29.778	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414235648	NA	1.77E-07	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	4.85E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	7.85E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	5.85E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	6.45E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	5.94E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	5.93E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.21E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.81E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	2.08E-08	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.51E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	5.93E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.15E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	7.30E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	6.66E-11	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	2.68E-06	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	7.77E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	2.02E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	4.54E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.75E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	6.47E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	1.31E-06	NA	mr1693	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.02E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	3.28E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.03E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	5.34E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	7.64E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	2.04E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.63E-07	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.94E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	2.02E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	9.99E-06	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	4.41E-10	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	3.75E-11	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.45E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	9.23E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	4.96E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	2.57E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	1.89E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414235648	NA	6.65E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251