\
| Variant ID: vg0414233780 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14233780 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 36. )
TTTCACTCGGTGCAAGGGGGGACCTGTCTCGTCCTGGGGGATCCGGCATCCTTTACCTTGTCGGGGACCGGCGGGCGGCGAAACCTCAGCGGGTTCTCCT[G/A]
TTTTGGGTAGACCTAGATGGATAGTCTTGTCACGACCTCTATTCGAGTACTGTGATAGTACCCGGTGCGTGGTAACGTGTGTTGAGGTTGTGTCTTGTGG
CCACAAGACACAACCTCAACACACGTTACCACGCACCGGGTACTATCACAGTACTCGAATAGAGGTCGTGACAAGACTATCCATCTAGGTCTACCCAAAA[C/T]
AGGAGAACCCGCTGAGGTTTCGCCGCCCGCCGGTCCCCGACAAGGTAAAGGATGCCGGATCCCCCAGGACGAGACAGGTCCCCCCTTGCACCGAGTGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.20% | 22.20% | 20.02% | 9.65% | NA |
| All Indica | 2759 | 44.20% | 15.80% | 26.60% | 13.41% | NA |
| All Japonica | 1512 | 54.40% | 35.50% | 8.60% | 1.52% | NA |
| Aus | 269 | 55.40% | 7.40% | 15.99% | 21.19% | NA |
| Indica I | 595 | 43.40% | 11.40% | 32.27% | 12.94% | NA |
| Indica II | 465 | 57.80% | 5.40% | 16.99% | 19.78% | NA |
| Indica III | 913 | 44.00% | 24.10% | 23.55% | 8.32% | NA |
| Indica Intermediate | 786 | 36.90% | 15.60% | 31.55% | 15.90% | NA |
| Temperate Japonica | 767 | 91.80% | 5.20% | 2.61% | 0.39% | NA |
| Tropical Japonica | 504 | 6.70% | 73.00% | 16.87% | 3.37% | NA |
| Japonica Intermediate | 241 | 34.90% | 53.50% | 10.37% | 1.24% | NA |
| VI/Aromatic | 96 | 41.70% | 35.40% | 18.75% | 4.17% | NA |
| Intermediate | 90 | 51.10% | 23.30% | 23.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414233780 | G -> DEL | N | N | silent_mutation | Average:18.324; most accessible tissue: Callus, score: 56.016 | N | N | N | N |
| vg0414233780 | G -> A | LOC_Os04g24780.1 | upstream_gene_variant ; 923.0bp to feature; MODIFIER | silent_mutation | Average:18.324; most accessible tissue: Callus, score: 56.016 | N | N | N | N |
| vg0414233780 | G -> A | LOC_Os04g24770-LOC_Os04g24780 | intergenic_region ; MODIFIER | silent_mutation | Average:18.324; most accessible tissue: Callus, score: 56.016 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414233780 | NA | 1.05E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414233780 | NA | 6.20E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414233780 | NA | 3.23E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414233780 | 2.16E-06 | NA | mr1662_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |