RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0414221572:

Variant ID: vg0414221572 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14221572
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGGAGCAATGAAATGTCGTGCAACATCTCCTCTTGATAGGGATTAAACAAATATGCATGCACCTACCTAGAAGCAATTTCTAAGTAAATTTCAATGGA[A/G]
CACGTTAAATTGTGCATGTGCAAAATTCTATATACATACTATTGACACCGAAAATTGGTTCCATGCCAATACACATTGGAGCACCTTTCATTCTTTCAAC

Reverse complement sequence

GTTGAAAGAATGAAAGGTGCTCCAATGTGTATTGGCATGGAACCAATTTTCGGTGTCAATAGTATGTATATAGAATTTTGCACATGCACAATTTAACGTG[T/C]
TCCATTGAAATTTACTTAGAAATTGCTTCTAGGTAGGTGCATGCATATTTGTTTAATCCCTATCAAGAGGAGATGTTGCACGACATTTCATTGCTCCAAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	23.30%	0.32%	0.00%	NA
All Indica	2759	89.30%	10.50%	0.25%	0.00%	NA
All Japonica	1512	47.70%	51.80%	0.53%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	66.10%	33.10%	0.84%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.20%	7.60%	0.13%	0.00%	NA
Temperate Japonica	767	9.50%	89.60%	0.91%	0.00%	NA
Tropical Japonica	504	96.20%	3.60%	0.20%	0.00%	NA
Japonica Intermediate	241	67.60%	32.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414221572	A -> G	LOC_Os04g24750-LOC_Os04g24770	intergenic_region ; MODIFIER	silent_mutation	Average:63.336; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414221572	NA	1.28E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0414221572	NA	1.94E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0414221572	NA	1.22E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	9.57E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	3.31E-09	mr1045	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	1.75E-15	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	3.22E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	1.60E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	8.28E-09	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414221572	NA	1.73E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 92 entries

Previous1 2 3 4 5…10Next

Search for Variation information by Variation ID:

Detailed information for vg0414221572:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact