Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414213447:

Variant ID: vg0414213447 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14213447
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCCCCATCTCGCAGCGACGCATGGATGCGGCGGCCCGTGACGAGGAAGAGCAGATCCGGTCGCCTCTTCCTCTCCCTCTCCGTTGGCTTCATCGAAGC[C/T]
GGCCAGATCTGGGGAGGGGGAGGTCGGGGTGGTGGGTTGGTGGCGGCGATGTCCGGCGGCGGTGGTACGGTGGCCAAGGTAGGTGGTGGGCGGCCTCCCC

Reverse complement sequence

GGGGAGGCCGCCCACCACCTACCTTGGCCACCGTACCACCGCCGCCGGACATCGCCGCCACCAACCCACCACCCCGACCTCCCCCTCCCCAGATCTGGCC[G/A]
GCTTCGATGAAGCCAACGGAGAGGGAGAGGAAGAGGCGACCGGATCTGCTCTTCCTCGTCACGGGCCGCCGCATCCATGCGTCGCTGCGAGATGGGGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 15.60% 16.61% 1.82% NA
All Indica  2759 66.90% 10.70% 19.57% 2.83% NA
All Japonica  1512 60.70% 25.70% 13.29% 0.33% NA
Aus  269 93.30% 2.60% 3.72% 0.37% NA
Indica I  595 65.20% 9.20% 22.18% 3.36% NA
Indica II  465 90.10% 3.70% 4.52% 1.72% NA
Indica III  913 57.20% 15.30% 24.32% 3.18% NA
Indica Intermediate  786 65.90% 10.40% 20.99% 2.67% NA
Temperate Japonica  767 94.50% 3.00% 2.48% 0.00% NA
Tropical Japonica  504 15.30% 58.70% 25.99% 0.00% NA
Japonica Intermediate  241 48.10% 28.60% 21.16% 2.07% NA
VI/Aromatic  96 45.80% 30.20% 22.92% 1.04% NA
Intermediate  90 65.60% 20.00% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414213447 C -> DEL N N silent_mutation Average:81.102; most accessible tissue: Zhenshan97 young leaf, score: 93.68 N N N N
vg0414213447 C -> T LOC_Os04g24750.1 downstream_gene_variant ; 2679.0bp to feature; MODIFIER silent_mutation Average:81.102; most accessible tissue: Zhenshan97 young leaf, score: 93.68 N N N N
vg0414213447 C -> T LOC_Os04g24750-LOC_Os04g24770 intergenic_region ; MODIFIER silent_mutation Average:81.102; most accessible tissue: Zhenshan97 young leaf, score: 93.68 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0414213447 C T 0.01 0.0 0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414213447 NA 1.42E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 6.99E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.18E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.41E-10 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.26E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 4.72E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 4.68E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.23E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.09E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 9.24E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.42E-07 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.14E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.79E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.79E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.28E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 7.35E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 5.73E-06 5.73E-06 mr1520 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.86E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.42E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.66E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 4.71E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.83E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.80E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.29E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.96E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 7.78E-06 8.71E-11 mr1715 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.54E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.95E-09 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.60E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.51E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 4.04E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.11E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.46E-07 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.33E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.09E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 2.36E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 9.11E-07 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 5.42E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 3.36E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 5.35E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 1.49E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 4.41E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 6.40E-08 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 9.98E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 4.05E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414213447 NA 6.94E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251