\
| Variant ID: vg0414211322 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14211322 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 105. )
GAGGCTAAATATTCACTGTCGATAACAATCAATGCTTAACTAGTCCTTTAAAAAAACTTAAAATTTAGCTCTTTAACAATAATAATCACTACTAGAAAAA[T/C]
AATTTTTCATGACGTCACACTATAATTTTCACTGGCGGTTATATGCTAAAACTACTAGCAAAAACATAAGCAGAGGTTGGGGGTATAGGACCACCAGCGA
TCGCTGGTGGTCCTATACCCCCAACCTCTGCTTATGTTTTTGCTAGTAGTTTTAGCATATAACCGCCAGTGAAAATTATAGTGTGACGTCATGAAAAATT[A/G]
TTTTTCTAGTAGTGATTATTATTGTTAAAGAGCTAAATTTTAAGTTTTTTTAAAGGACTAGTTAAGCATTGATTGTTATCGACAGTGAATATTTAGCCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 36.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 18.40% | 81.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 23.20% | 76.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 64.60% | 35.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414211322 | T -> C | LOC_Os04g24750.1 | downstream_gene_variant ; 554.0bp to feature; MODIFIER | silent_mutation | Average:58.619; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0414211322 | T -> C | LOC_Os04g24750-LOC_Os04g24770 | intergenic_region ; MODIFIER | silent_mutation | Average:58.619; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414211322 | NA | 8.30E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 1.43E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 3.54E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 8.74E-09 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 2.21E-06 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 7.97E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 7.49E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | 1.55E-08 | 3.84E-12 | mr1729 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 3.21E-08 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 4.24E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 9.23E-07 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414211322 | NA | 1.15E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |