RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0414209075:

Variant ID: vg0414209075 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14209075
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAATATTTGCATTGACAAACACAAGACCCCCGAAGAAATTAGGATGACTCCCACACGGGAGTGGATTCTAATCCCTCAAGGGGATATCCCCTCGTATA[T/C]
CTTTTTTTTTCAAATTCGATGTAAATAGTTGTGAAAAATTCTAAAAACAATTGACAATGTAGAGTATAATGATACCTATTAGTCCACCAAAATTCATGTT

Reverse complement sequence

AACATGAATTTTGGTGGACTAATAGGTATCATTATACTCTACATTGTCAATTGTTTTTAGAATTTTTCACAACTATTTACATCGAATTTGAAAAAAAAAG[A/G]
TATACGAGGGGATATCCCCTTGAGGGATTAGAATCCACTCCCGTGTGGGAGTCATCCTAATTTCTTCGGGGGTCTTGTGTTTGTCAATGCAAATATTTCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.30%	33.50%	1.21%	30.98%	NA
All Indica	2759	11.60%	46.00%	0.25%	42.15%	NA
All Japonica	1512	83.10%	14.60%	1.52%	0.86%	NA
Aus	269	0.40%	4.80%	0.00%	94.80%	NA
Indica I	595	35.10%	36.10%	0.50%	28.24%	NA
Indica II	465	3.90%	31.80%	0.00%	64.30%	NA
Indica III	913	2.30%	63.60%	0.00%	34.06%	NA
Indica Intermediate	786	9.30%	41.20%	0.51%	48.98%	NA
Temperate Japonica	767	96.20%	3.40%	0.13%	0.26%	NA
Tropical Japonica	504	74.20%	20.20%	4.37%	1.19%	NA
Japonica Intermediate	241	59.80%	38.20%	0.00%	2.07%	NA
VI/Aromatic	96	11.50%	51.00%	26.04%	11.46%	NA
Intermediate	90	35.60%	37.80%	2.22%	24.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414209075	T -> C	LOC_Os04g24750.1	upstream_gene_variant ; 498.0bp to feature; MODIFIER	silent_mutation	Average:58.699; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N
vg0414209075	T -> C	LOC_Os04g24730-LOC_Os04g24750	intergenic_region ; MODIFIER	silent_mutation	Average:58.699; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N
vg0414209075	T -> DEL	N	N	silent_mutation	Average:58.699; most accessible tissue: Zhenshan97 root, score: 73.6	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414209075	NA	7.28E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	8.35E-06	1.60E-07	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	5.23E-06	8.03E-10	mr1280	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	NA	3.52E-06	mr1298	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	NA	3.79E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	NA	2.24E-06	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	NA	9.60E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	2.11E-06	1.28E-07	mr1380	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	NA	6.73E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209075	4.41E-07	2.54E-10	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0414209075:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact