| Variant ID: vg0414202857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14202857 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )
TCGGCGCGAGCGTGCGCGGGATTGGTGCAAGGCAACACGGCGCTGGCTCGGTCCGGAAATGCTGTTTGGCGATTGCTCGCCCTGGGGAGGGGGTAGCGAT[C/A]
AGATTCGCTCCCCACCTCCCCCCTCCCTCCCTCCACCTATTTCCTTTTTTGTCACCGCATTACTTTCCTATTTTAGTAAATTTATGCACCTAAAATTTAT
ATAAATTTTAGGTGCATAAATTTACTAAAATAGGAAAGTAATGCGGTGACAAAAAAGGAAATAGGTGGAGGGAGGGAGGGGGGAGGTGGGGAGCGAATCT[G/T]
ATCGCTACCCCCTCCCCAGGGCGAGCAATCGCCAAACAGCATTTCCGGACCGAGCCAGCGCCGTGTTGCCTTGCACCAATCCCGCGCACGCTCGCGCCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 30.20% | 1.44% | 3.45% | NA |
| All Indica | 2759 | 53.00% | 40.80% | 1.85% | 4.35% | NA |
| All Japonica | 1512 | 82.50% | 14.10% | 0.79% | 2.65% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.50% | 35.30% | 1.51% | 3.70% | NA |
| Indica II | 465 | 71.20% | 12.70% | 3.23% | 12.90% | NA |
| Indica III | 913 | 37.50% | 61.80% | 0.55% | 0.22% | NA |
| Indica Intermediate | 786 | 55.30% | 37.30% | 2.80% | 4.58% | NA |
| Temperate Japonica | 767 | 91.30% | 3.30% | 0.78% | 4.69% | NA |
| Tropical Japonica | 504 | 79.20% | 19.60% | 0.79% | 0.40% | NA |
| Japonica Intermediate | 241 | 61.40% | 36.90% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 47.90% | 51.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 28.90% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414202857 | C -> DEL | N | N | silent_mutation | Average:51.959; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0414202857 | C -> A | LOC_Os04g24730.1 | downstream_gene_variant ; 4154.0bp to feature; MODIFIER | silent_mutation | Average:51.959; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0414202857 | C -> A | LOC_Os04g24730-LOC_Os04g24750 | intergenic_region ; MODIFIER | silent_mutation | Average:51.959; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414202857 | NA | 2.00E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 8.36E-09 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 7.29E-06 | mr1298 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 6.62E-06 | mr1337 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | 3.84E-06 | 4.01E-06 | mr1359 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 1.43E-06 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 6.19E-06 | mr1494 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | 1.53E-06 | 1.35E-09 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 1.92E-08 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202857 | NA | 9.07E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/