| Variant ID: vg0414202308 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14202308 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 63. )
GGTGCAGGCGGCGGCGGCCTGGAGCAGGAGGCGGCAGCGGCCATGGTCGCGGTGGTTCCAGCGAACTTCGGTGAGGGTGATGGCTATGGTGAGCATCAGT[A/G]
GAGCAAGGGGAGCGCGGTGGTGGCGGCAGCTCGGCCTGGGGCGGCCTGGAGCTGTGGCCGAACAGAGCGGCGACACCGGGAGGCGGCGCCGGCGGCACTC
GAGTGCCGCCGGCGCCGCCTCCCGGTGTCGCCGCTCTGTTCGGCCACAGCTCCAGGCCGCCCCAGGCCGAGCTGCCGCCACCACCGCGCTCCCCTTGCTC[T/C]
ACTGATGCTCACCATAGCCATCACCCTCACCGAAGTTCGCTGGAACCACCGCGACCATGGCCGCTGCCGCCTCCTGCTCCAGGCCGCCGCCGCCTGCACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 25.00% | 2.54% | 6.14% | NA |
| All Indica | 2759 | 75.40% | 11.10% | 3.30% | 10.22% | NA |
| All Japonica | 1512 | 43.90% | 55.80% | 0.13% | 0.13% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 52.40% | 35.00% | 3.03% | 9.58% | NA |
| Indica II | 465 | 63.40% | 3.20% | 5.59% | 27.74% | NA |
| Indica III | 913 | 96.30% | 2.00% | 0.99% | 0.77% | NA |
| Indica Intermediate | 786 | 75.70% | 8.10% | 4.83% | 11.32% | NA |
| Temperate Japonica | 767 | 5.70% | 94.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.70% | 41.10% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 63.50% | 10.40% | 26.04% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 23.30% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414202308 | A -> DEL | N | N | silent_mutation | Average:59.601; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0414202308 | A -> G | LOC_Os04g24730.1 | downstream_gene_variant ; 3605.0bp to feature; MODIFIER | silent_mutation | Average:59.601; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0414202308 | A -> G | LOC_Os04g24730-LOC_Os04g24750 | intergenic_region ; MODIFIER | silent_mutation | Average:59.601; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414202308 | NA | 4.31E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 4.73E-09 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 5.42E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 2.10E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 7.14E-16 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 9.25E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 4.56E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | 7.42E-06 | 1.08E-10 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 1.98E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414202308 | NA | 1.77E-09 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/