Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414177229:

Variant ID: vg0414177229 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14177229
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, A: 0.13, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAAAATCTAACAAAATCATATCATCGCCATATTACAAAATACTATAACTATTTTTTGATTTCACCGAATAAATAGACATTTAAAATTTTATTCTCTCT[C/A]
TATATATGACAAGATCTAGATCTAGATCTAGAACTAGGAGGTGGATGTGATAGCAAAAATAAAAAAAATTGAGAATTTATGTTACCACATTAAACCACTA

Reverse complement sequence

TAGTGGTTTAATGTGGTAACATAAATTCTCAATTTTTTTTATTTTTGCTATCACATCCACCTCCTAGTTCTAGATCTAGATCTAGATCTTGTCATATATA[G/T]
AGAGAGAATAAAATTTTAAATGTCTATTTATTCGGTGAAATCAAAAAATAGTTATAGTATTTTGTAATATGGCGATGATATGATTTTGTTAGATTTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	7.30%	2.67%	0.00%	NA
All Indica	2759	98.20%	1.40%	0.40%	0.00%	NA
All Japonica	1512	73.10%	19.60%	7.34%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	98.30%	1.10%	0.65%	0.00%	NA
Indica III	913	97.90%	1.50%	0.55%	0.00%	NA
Indica Intermediate	786	98.10%	1.70%	0.25%	0.00%	NA
Temperate Japonica	767	98.30%	1.40%	0.26%	0.00%	NA
Tropical Japonica	504	31.90%	49.40%	18.65%	0.00%	NA
Japonica Intermediate	241	78.80%	14.90%	6.22%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	91.10%	5.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414177229	C -> A	LOC_Os04g24690.1	upstream_gene_variant ; 291.0bp to feature; MODIFIER	silent_mutation	Average:20.674; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0414177229	C -> A	LOC_Os04g24700.1	upstream_gene_variant ; 3451.0bp to feature; MODIFIER	silent_mutation	Average:20.674; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0414177229	C -> A	LOC_Os04g24690-LOC_Os04g24700	intergenic_region ; MODIFIER	silent_mutation	Average:20.674; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414177229	NA	3.06E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414177229	NA	3.06E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414177229	NA	1.19E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414177229	9.49E-06	5.22E-08	mr1887	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251