| Variant ID: vg0414176940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14176940 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 213. )
CTTCCTCATATTGTTCTTCTCAGCGTGTGCCTTGGCAATACCAATAAATTTAGACACTTCGTTTCTATATGGAGACAAAAATCTCGGCCAATGATACATC[C/T]
ATTCCCGACTTTCCGTATCTCTAAAAGAATACACGTAAAATATTTGCACAATTAATACCAAATTTGTAGGGTTTATTGAAAAAACTTATCGCTATTCAAA
TTTGAATAGCGATAAGTTTTTTCAATAAACCCTACAAATTTGGTATTAATTGTGCAAATATTTTACGTGTATTCTTTTAGAGATACGGAAAGTCGGGAAT[G/A]
GATGTATCATTGGCCGAGATTTTTGTCTCCATATAGAAACGAAGTGTCTAAATTTATTGGTATTGCCAAGGCACACGCTGAGAAGAACAATATGAGGAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 40.40% | 0.53% | 1.27% | NA |
| All Indica | 2759 | 55.20% | 41.80% | 0.87% | 2.14% | NA |
| All Japonica | 1512 | 56.50% | 43.40% | 0.00% | 0.07% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.00% | 35.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 72.00% | 13.50% | 3.01% | 11.40% | NA |
| Indica III | 913 | 37.00% | 62.80% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 59.50% | 38.90% | 0.89% | 0.64% | NA |
| Temperate Japonica | 767 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 42.70% | 56.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414176940 | C -> DEL | N | N | silent_mutation | Average:17.469; most accessible tissue: Callus, score: 25.969 | N | N | N | N |
| vg0414176940 | C -> T | LOC_Os04g24690.1 | upstream_gene_variant ; 2.0bp to feature; MODIFIER | silent_mutation | Average:17.469; most accessible tissue: Callus, score: 25.969 | N | N | N | N |
| vg0414176940 | C -> T | LOC_Os04g24700.1 | upstream_gene_variant ; 3740.0bp to feature; MODIFIER | silent_mutation | Average:17.469; most accessible tissue: Callus, score: 25.969 | N | N | N | N |
| vg0414176940 | C -> T | LOC_Os04g24690-LOC_Os04g24700 | intergenic_region ; MODIFIER | silent_mutation | Average:17.469; most accessible tissue: Callus, score: 25.969 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414176940 | NA | 4.19E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 1.21E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 5.50E-09 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 7.69E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 1.23E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 4.14E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 4.47E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 5.09E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 1.71E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414176940 | NA | 2.49E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/