RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0414176233:

Variant ID: vg0414176233 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14176233
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAGGTACCACATCACAAGCTGCGGGATTTTTCTCTGTCGTCCCTCAGTTGCTTCAGAGGGTTCTAGGCCAGTATTGCTATTCGACTTGTACCGGCTTG[C/T]
ACCGCATGTTGGACATTCATCTAAAGAAGCGTAATCTTTCCTGTACAGTATGCAGTGATTTACGCACGCATGAATCTTTTCCACACCAAGTGAAAGGGGG

Reverse complement sequence

CCCCCTTTCACTTGGTGTGGAAAAGATTCATGCGTGCGTAAATCACTGCATACTGTACAGGAAAGATTACGCTTCTTTAGATGAATGTCCAACATGCGGT[G/A]
CAAGCCGGTACAAGTCGAATAGCAATACTGGCCTAGAACCCTCTGAAGCAACTGAGGGACGACAGAGAAAAATCCCGCAGCTTGTGATGTGGTACCTTCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	30.40%	7.28%	0.00%	NA
All Indica	2759	61.40%	27.80%	10.80%	0.00%	NA
All Japonica	1512	58.20%	39.60%	2.18%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	65.50%	24.70%	9.75%	0.00%	NA
Indica II	465	86.70%	9.50%	3.87%	0.00%	NA
Indica III	913	44.40%	40.70%	14.90%	0.00%	NA
Indica Intermediate	786	63.20%	25.80%	10.94%	0.00%	NA
Temperate Japonica	767	94.40%	5.00%	0.65%	0.00%	NA
Tropical Japonica	504	9.90%	86.90%	3.17%	0.00%	NA
Japonica Intermediate	241	44.00%	51.00%	4.98%	0.00%	NA
VI/Aromatic	96	55.20%	37.50%	7.29%	0.00%	NA
Intermediate	90	64.40%	28.90%	6.67%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414176233	C -> T	LOC_Os04g24690.1	missense_variant ; p.Ala236Thr; MODERATE	nonsynonymous_codon ; A236T	Average:16.194; most accessible tissue: Minghui63 root, score: 19.68	possibly damaging	1.571	TOLERATED	0.51

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414176233	NA	6.90E-09	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	2.49E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	4.37E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	7.65E-08	mr1338	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	5.22E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	3.02E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	1.00E-10	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	5.64E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	2.07E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233	NA	6.28E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 19 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0414176233:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact