\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414176233:

Variant ID: vg0414176233 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14176233
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAGGTACCACATCACAAGCTGCGGGATTTTTCTCTGTCGTCCCTCAGTTGCTTCAGAGGGTTCTAGGCCAGTATTGCTATTCGACTTGTACCGGCTTG[C/T]
ACCGCATGTTGGACATTCATCTAAAGAAGCGTAATCTTTCCTGTACAGTATGCAGTGATTTACGCACGCATGAATCTTTTCCACACCAAGTGAAAGGGGG

Reverse complement sequence

CCCCCTTTCACTTGGTGTGGAAAAGATTCATGCGTGCGTAAATCACTGCATACTGTACAGGAAAGATTACGCTTCTTTAGATGAATGTCCAACATGCGGT[G/A]
CAAGCCGGTACAAGTCGAATAGCAATACTGGCCTAGAACCCTCTGAAGCAACTGAGGGACGACAGAGAAAAATCCCGCAGCTTGTGATGTGGTACCTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 30.40% 7.28% 0.00% NA
All Indica  2759 61.40% 27.80% 10.80% 0.00% NA
All Japonica  1512 58.20% 39.60% 2.18% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 65.50% 24.70% 9.75% 0.00% NA
Indica II  465 86.70% 9.50% 3.87% 0.00% NA
Indica III  913 44.40% 40.70% 14.90% 0.00% NA
Indica Intermediate  786 63.20% 25.80% 10.94% 0.00% NA
Temperate Japonica  767 94.40% 5.00% 0.65% 0.00% NA
Tropical Japonica  504 9.90% 86.90% 3.17% 0.00% NA
Japonica Intermediate  241 44.00% 51.00% 4.98% 0.00% NA
VI/Aromatic  96 55.20% 37.50% 7.29% 0.00% NA
Intermediate  90 64.40% 28.90% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414176233 C -> T LOC_Os04g24690.1 missense_variant ; p.Ala236Thr; MODERATE nonsynonymous_codon ; A236T Average:16.194; most accessible tissue: Minghui63 root, score: 19.68 possibly damaging 1.571 TOLERATED 0.51

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414176233 NA 6.90E-09 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 2.49E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 4.37E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 7.65E-08 mr1338 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 5.22E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 3.02E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 1.00E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 5.64E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 2.07E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 6.28E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 2.44E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 3.45E-06 mr1579 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 9.18E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 6.32E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 6.67E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 3.89E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 1.25E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 6.44E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414176233 NA 1.35E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251