| Variant ID: vg0414127903 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14127903 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 86. )
GGTCACCGCCTTCGAGTGGTTTGACGGGCACATCTCAGGCTGAAGTTGACTGGCAGGCTAAAGGCCTAGCAATGTCTCCAATATTCTTCTCTCGAGGCGT[T/C]
GGATGTTTCATTATGTTTGTTTGATGACTTGAATTATTCACTTCATCCCTCAAATATAATATAATGTAAGGTCTAGAAAGCCTACGACAATACTGCCATT
AATGGCAGTATTGTCGTAGGCTTTCTAGACCTTACATTATATTATATTTGAGGGATGAAGTGAATAATTCAAGTCATCAAACAAACATAATGAAACATCC[A/G]
ACGCCTCGAGAGAAGAATATTGGAGACATTGCTAGGCCTTTAGCCTGCCAGTCAACTTCAGCCTGAGATGTGCCCGTCAAACCACTCGAAGGCGGTGACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 25.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 88.20% | 11.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 43.70% | 56.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.70% | 36.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.10% | 8.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414127903 | T -> C | LOC_Os04g24590.1 | upstream_gene_variant ; 1021.0bp to feature; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0414127903 | T -> C | LOC_Os04g24600.1 | upstream_gene_variant ; 1711.0bp to feature; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0414127903 | T -> C | LOC_Os04g24610.1 | downstream_gene_variant ; 3742.0bp to feature; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0414127903 | T -> C | LOC_Os04g24610.2 | downstream_gene_variant ; 3742.0bp to feature; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0414127903 | T -> C | LOC_Os04g24590-LOC_Os04g24600 | intergenic_region ; MODIFIER | silent_mutation | Average:54.565; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414127903 | NA | 2.52E-07 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 7.27E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 9.91E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 3.72E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 4.68E-10 | mr1252 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 1.40E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 1.42E-06 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 7.25E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 7.46E-07 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414127903 | NA | 8.74E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/