\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414127700:

Variant ID: vg0414127700 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14127700
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGCCAATGTAACTAAAGTAGATGTAGTTTATAATCGCTTTCATCTTATTTGTGTTTGCTATGTATAATCATGCTTGAGATGAAAGTGTGAATCTAGTG[C/T]
ACATCCTGGGAACTAGATTCACATGAGTATGAGTTAAGAATATTTGAGATGATGTAGATCTTTAGCCATTTTTGTCAAGTCTCCTGAATGTGTAACACAT

Reverse complement sequence

ATGTGTTACACATTCAGGAGACTTGACAAAAATGGCTAAAGATCTACATCATCTCAAATATTCTTAACTCATACTCATGTGAATCTAGTTCCCAGGATGT[G/A]
CACTAGATTCACACTTTCATCTCAAGCATGATTATACATAGCAAACACAAATAAGATGAAAGCGATTATAAACTACATCTACTTTAGTTACATTGGCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 30.40% 0.04% 0.00% NA
All Indica  2759 58.20% 41.70% 0.04% 0.00% NA
All Japonica  1512 87.00% 13.00% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 53.10% 46.90% 0.00% 0.00% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 48.30% 51.70% 0.00% 0.00% NA
Indica Intermediate  786 55.90% 44.00% 0.13% 0.00% NA
Temperate Japonica  767 96.60% 3.40% 0.00% 0.00% NA
Tropical Japonica  504 83.30% 16.70% 0.00% 0.00% NA
Japonica Intermediate  241 63.90% 36.10% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414127700 C -> T LOC_Os04g24590.1 upstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0414127700 C -> T LOC_Os04g24600.1 upstream_gene_variant ; 1914.0bp to feature; MODIFIER silent_mutation Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0414127700 C -> T LOC_Os04g24610.1 downstream_gene_variant ; 3945.0bp to feature; MODIFIER silent_mutation Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0414127700 C -> T LOC_Os04g24610.2 downstream_gene_variant ; 3945.0bp to feature; MODIFIER silent_mutation Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg0414127700 C -> T LOC_Os04g24590-LOC_Os04g24600 intergenic_region ; MODIFIER silent_mutation Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414127700 NA 2.20E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 6.20E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 1.40E-06 1.39E-06 mr1705 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 8.96E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 9.87E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 1.76E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 1.87E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 9.82E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 2.55E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 5.18E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 4.56E-06 4.55E-06 mr1651_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 3.29E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 3.19E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 9.76E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 5.06E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 9.13E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700 NA 5.13E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251