Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414127700:

Variant ID: vg0414127700 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14127700
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGCCAATGTAACTAAAGTAGATGTAGTTTATAATCGCTTTCATCTTATTTGTGTTTGCTATGTATAATCATGCTTGAGATGAAAGTGTGAATCTAGTG[C/T]
ACATCCTGGGAACTAGATTCACATGAGTATGAGTTAAGAATATTTGAGATGATGTAGATCTTTAGCCATTTTTGTCAAGTCTCCTGAATGTGTAACACAT

Reverse complement sequence

ATGTGTTACACATTCAGGAGACTTGACAAAAATGGCTAAAGATCTACATCATCTCAAATATTCTTAACTCATACTCATGTGAATCTAGTTCCCAGGATGT[G/A]
CACTAGATTCACACTTTCATCTCAAGCATGATTATACATAGCAAACACAAATAAGATGAAAGCGATTATAAACTACATCTACTTTAGTTACATTGGCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	30.40%	0.04%	0.00%	NA
All Indica	2759	58.20%	41.70%	0.04%	0.00%	NA
All Japonica	1512	87.00%	13.00%	0.00%	0.00%	NA
Aus	269	95.20%	4.80%	0.00%	0.00%	NA
Indica I	595	53.10%	46.90%	0.00%	0.00%	NA
Indica II	465	88.40%	11.60%	0.00%	0.00%	NA
Indica III	913	48.30%	51.70%	0.00%	0.00%	NA
Indica Intermediate	786	55.90%	44.00%	0.13%	0.00%	NA
Temperate Japonica	767	96.60%	3.40%	0.00%	0.00%	NA
Tropical Japonica	504	83.30%	16.70%	0.00%	0.00%	NA
Japonica Intermediate	241	63.90%	36.10%	0.00%	0.00%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414127700	C -> T	LOC_Os04g24590.1	upstream_gene_variant ; 818.0bp to feature; MODIFIER	silent_mutation	Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N
vg0414127700	C -> T	LOC_Os04g24600.1	upstream_gene_variant ; 1914.0bp to feature; MODIFIER	silent_mutation	Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N
vg0414127700	C -> T	LOC_Os04g24610.1	downstream_gene_variant ; 3945.0bp to feature; MODIFIER	silent_mutation	Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N
vg0414127700	C -> T	LOC_Os04g24610.2	downstream_gene_variant ; 3945.0bp to feature; MODIFIER	silent_mutation	Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N
vg0414127700	C -> T	LOC_Os04g24590-LOC_Os04g24600	intergenic_region ; MODIFIER	silent_mutation	Average:45.625; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414127700	NA	2.20E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	6.20E-07	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	1.40E-06	1.39E-06	mr1705	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	8.96E-08	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	9.87E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	1.76E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	1.87E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	9.82E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	2.55E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	5.18E-06	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	4.56E-06	4.55E-06	mr1651_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	3.29E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	3.19E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	9.76E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	5.06E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	9.13E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414127700	NA	5.13E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251