\
| Variant ID: vg0414062987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14062987 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 213. )
TCTCTTATTTGGAAATAATTAAAGCTGAACAGGTTGGCTAAGCAAACATTATTTAGGTTTAAGCGACCCCCCAGCCTTGGCAAGCTCCTCCAGCTTACTG[T/C]
CAATTTGTGCTTCTGTCAGGCCATCCAAGCGCACGCACCTCTCAACGCCCATATCTGACCAGTAGACAGGCAGAATTTACAATCAGGGGGAAGCATAAAT
ATTTATGCTTCCCCCTGATTGTAAATTCTGCCTGTCTACTGGTCAGATATGGGCGTTGAGAGGTGCGTGCGCTTGGATGGCCTGACAGAAGCACAAATTG[A/G]
CAGTAAGCTGGAGGAGCTTGCCAAGGCTGGGGGGTCGCTTAAACCTAAATAATGTTTGCTTAGCCAACCTGTTCAGCTTTAATTATTTCCAAATAAGAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.90% | 50.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 57.60% | 42.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.50% | 36.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 51.00% | 47.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414062987 | T -> C | LOC_Os04g24510.1 | downstream_gene_variant ; 1699.0bp to feature; MODIFIER | silent_mutation | Average:71.138; most accessible tissue: Callus, score: 82.888 | N | N | N | N |
| vg0414062987 | T -> C | LOC_Os04g24520.1 | downstream_gene_variant ; 4017.0bp to feature; MODIFIER | silent_mutation | Average:71.138; most accessible tissue: Callus, score: 82.888 | N | N | N | N |
| vg0414062987 | T -> C | LOC_Os04g24510-LOC_Os04g24520 | intergenic_region ; MODIFIER | silent_mutation | Average:71.138; most accessible tissue: Callus, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414062987 | NA | 3.03E-06 | mr1066 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 2.01E-07 | mr1269 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 9.24E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | 3.01E-06 | NA | mr1584 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | 8.96E-06 | 8.96E-06 | mr1584 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 1.41E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 6.13E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | 3.59E-06 | 3.58E-06 | mr1651_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 7.48E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 5.80E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414062987 | NA | 1.78E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |