Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414062987:

Variant ID: vg0414062987 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14062987
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTATTTGGAAATAATTAAAGCTGAACAGGTTGGCTAAGCAAACATTATTTAGGTTTAAGCGACCCCCCAGCCTTGGCAAGCTCCTCCAGCTTACTG[T/C]
CAATTTGTGCTTCTGTCAGGCCATCCAAGCGCACGCACCTCTCAACGCCCATATCTGACCAGTAGACAGGCAGAATTTACAATCAGGGGGAAGCATAAAT

Reverse complement sequence

ATTTATGCTTCCCCCTGATTGTAAATTCTGCCTGTCTACTGGTCAGATATGGGCGTTGAGAGGTGCGTGCGCTTGGATGGCCTGACAGAAGCACAAATTG[A/G]
CAGTAAGCTGGAGGAGCTTGCCAAGGCTGGGGGGTCGCTTAAACCTAAATAATGTTTGCTTAGCCAACCTGTTCAGCTTTAATTATTTCCAAATAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	31.80%	0.02%	0.00%	NA
All Indica	2759	56.50%	43.50%	0.00%	0.00%	NA
All Japonica	1512	86.90%	13.10%	0.00%	0.00%	NA
Aus	269	89.20%	10.80%	0.00%	0.00%	NA
Indica I	595	51.10%	48.90%	0.00%	0.00%	NA
Indica II	465	74.20%	25.80%	0.00%	0.00%	NA
Indica III	913	49.90%	50.10%	0.00%	0.00%	NA
Indica Intermediate	786	57.60%	42.40%	0.00%	0.00%	NA
Temperate Japonica	767	96.90%	3.10%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	63.50%	36.50%	0.00%	0.00%	NA
VI/Aromatic	96	51.00%	47.90%	1.04%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414062987	T -> C	LOC_Os04g24510.1	downstream_gene_variant ; 1699.0bp to feature; MODIFIER	silent_mutation	Average:71.138; most accessible tissue: Callus, score: 82.888	N	N	N	N
vg0414062987	T -> C	LOC_Os04g24520.1	downstream_gene_variant ; 4017.0bp to feature; MODIFIER	silent_mutation	Average:71.138; most accessible tissue: Callus, score: 82.888	N	N	N	N
vg0414062987	T -> C	LOC_Os04g24510-LOC_Os04g24520	intergenic_region ; MODIFIER	silent_mutation	Average:71.138; most accessible tissue: Callus, score: 82.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414062987	NA	3.03E-06	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	2.01E-07	mr1269	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	9.24E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	3.01E-06	NA	mr1584	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	8.96E-06	8.96E-06	mr1584	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	1.41E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	6.13E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	3.59E-06	3.58E-06	mr1651_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	7.48E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	5.80E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987	NA	1.78E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251