\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414062987:

Variant ID: vg0414062987 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14062987
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTATTTGGAAATAATTAAAGCTGAACAGGTTGGCTAAGCAAACATTATTTAGGTTTAAGCGACCCCCCAGCCTTGGCAAGCTCCTCCAGCTTACTG[T/C]
CAATTTGTGCTTCTGTCAGGCCATCCAAGCGCACGCACCTCTCAACGCCCATATCTGACCAGTAGACAGGCAGAATTTACAATCAGGGGGAAGCATAAAT

Reverse complement sequence

ATTTATGCTTCCCCCTGATTGTAAATTCTGCCTGTCTACTGGTCAGATATGGGCGTTGAGAGGTGCGTGCGCTTGGATGGCCTGACAGAAGCACAAATTG[A/G]
CAGTAAGCTGGAGGAGCTTGCCAAGGCTGGGGGGTCGCTTAAACCTAAATAATGTTTGCTTAGCCAACCTGTTCAGCTTTAATTATTTCCAAATAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.80% 0.02% 0.00% NA
All Indica  2759 56.50% 43.50% 0.00% 0.00% NA
All Japonica  1512 86.90% 13.10% 0.00% 0.00% NA
Aus  269 89.20% 10.80% 0.00% 0.00% NA
Indica I  595 51.10% 48.90% 0.00% 0.00% NA
Indica II  465 74.20% 25.80% 0.00% 0.00% NA
Indica III  913 49.90% 50.10% 0.00% 0.00% NA
Indica Intermediate  786 57.60% 42.40% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 82.90% 17.10% 0.00% 0.00% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 47.90% 1.04% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414062987 T -> C LOC_Os04g24510.1 downstream_gene_variant ; 1699.0bp to feature; MODIFIER silent_mutation Average:71.138; most accessible tissue: Callus, score: 82.888 N N N N
vg0414062987 T -> C LOC_Os04g24520.1 downstream_gene_variant ; 4017.0bp to feature; MODIFIER silent_mutation Average:71.138; most accessible tissue: Callus, score: 82.888 N N N N
vg0414062987 T -> C LOC_Os04g24510-LOC_Os04g24520 intergenic_region ; MODIFIER silent_mutation Average:71.138; most accessible tissue: Callus, score: 82.888 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414062987 NA 3.03E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 2.01E-07 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 9.24E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 3.01E-06 NA mr1584 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 8.96E-06 8.96E-06 mr1584 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 1.41E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 6.13E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 3.59E-06 3.58E-06 mr1651_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 7.48E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 5.80E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414062987 NA 1.78E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251