\
| Variant ID: vg0414059978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14059978 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTTTTTGGTGAGTTATGTACTCCATTCAATTTCACCATGCAGAAAAAGAAAATTAAAAAAAAAGTAAATAATGTACTAGCAAAGCATGCATAACCATCG[G/T]
CTGCCTCATTATTTAGGTATCGTCATTGGACTTAGTGCTGGCTTTGGAATTCTACTGCCTGGCTTAAGCGCAAAAATGCTCTTCCATAAATGGAAGAAAG
CTTTCTTCCATTTATGGAAGAGCATTTTTGCGCTTAAGCCAGGCAGTAGAATTCCAAAGCCAGCACTAAGTCCAATGACGATACCTAAATAATGAGGCAG[C/A]
CGATGGTTATGCATGCTTTGCTAGTACATTATTTACTTTTTTTTTAATTTTCTTTTTCTGCATGGTGAAATTGAATGGAGTACATAACTCACCAAAAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 19.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 68.30% | 31.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 65.00% | 34.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414059978 | G -> T | LOC_Os04g24510.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.57; most accessible tissue: Callus, score: 72.115 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414059978 | NA | 8.07E-08 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 2.82E-09 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 2.20E-08 | mr1066 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 1.87E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 7.25E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 4.02E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 3.93E-06 | mr1216 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 8.34E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 7.47E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 2.54E-06 | mr1705 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 5.71E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414059978 | NA | 9.54E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |