\
| Variant ID: vg0414050911 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14050911 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACAGAGGCATTAAACAAGACAATTGCTATGTATCTCCATTGTCTAGTTGGTGATCGTCCTCGCAAATGGCTTCAGTGGCTTACAATACTTCTTTTCAGTC[G/A]
TCGCTGAAGGAGACACCTTTCAAAGTGTCGTATGGCAGGAATCCCCCAACAATTCAATCATATGAGCCAGGTACGGCCAAGGTGGCGGCCGTAGATCAGC
GCTGATCTACGGCCGCCACCTTGGCCGTACCTGGCTCATATGATTGAATTGTTGGGGGATTCCTGCCATACGACACTTTGAAAGGTGTCTCCTTCAGCGA[C/T]
GACTGAAAAGAAGTATTGTAAGCCACTGAAGCCATTTGCGAGGACGATCACCAACTAGACAATGGAGATACATAGCAATTGTCTTGTTTAATGCCTCTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 12.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 12.60% | 87.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.70% | 16.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414050911 | G -> A | LOC_Os04g24490.1 | downstream_gene_variant ; 2482.0bp to feature; MODIFIER | silent_mutation | Average:39.041; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| vg0414050911 | G -> A | LOC_Os04g24500.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.041; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414050911 | NA | 4.02E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | NA | 1.93E-10 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | 8.32E-06 | NA | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | NA | 1.41E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | NA | 9.88E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | NA | 4.46E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | 3.23E-10 | NA | mr1730_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | 2.26E-07 | 2.26E-07 | mr1730_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | NA | 1.78E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414050911 | 2.43E-07 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |