\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414050911:

Variant ID: vg0414050911 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14050911
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGAGGCATTAAACAAGACAATTGCTATGTATCTCCATTGTCTAGTTGGTGATCGTCCTCGCAAATGGCTTCAGTGGCTTACAATACTTCTTTTCAGTC[G/A]
TCGCTGAAGGAGACACCTTTCAAAGTGTCGTATGGCAGGAATCCCCCAACAATTCAATCATATGAGCCAGGTACGGCCAAGGTGGCGGCCGTAGATCAGC

Reverse complement sequence

GCTGATCTACGGCCGCCACCTTGGCCGTACCTGGCTCATATGATTGAATTGTTGGGGGATTCCTGCCATACGACACTTTGAAAGGTGTCTCCTTCAGCGA[C/T]
GACTGAAAAGAAGTATTGTAAGCCACTGAAGCCATTTGCGAGGACGATCACCAACTAGACAATGGAGATACATAGCAATTGTCTTGTTTAATGCCTCTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.50% 0.02% 0.00% NA
All Indica  2759 89.80% 10.20% 0.00% 0.00% NA
All Japonica  1512 87.60% 12.40% 0.07% 0.00% NA
Aus  269 12.60% 87.40% 0.00% 0.00% NA
Indica I  595 88.10% 11.90% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 88.90% 11.10% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 83.70% 16.10% 0.20% 0.00% NA
Japonica Intermediate  241 64.70% 35.30% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414050911 G -> A LOC_Os04g24490.1 downstream_gene_variant ; 2482.0bp to feature; MODIFIER silent_mutation Average:39.041; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N
vg0414050911 G -> A LOC_Os04g24500.1 intron_variant ; MODIFIER silent_mutation Average:39.041; most accessible tissue: Zhenshan97 young leaf, score: 50.669 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414050911 NA 4.02E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 NA 1.93E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 8.32E-06 NA mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 NA 1.41E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 NA 9.88E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 NA 4.46E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 3.23E-10 NA mr1730_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 2.26E-07 2.26E-07 mr1730_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 NA 1.78E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414050911 2.43E-07 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251