\
| Variant ID: vg0414030990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14030990 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCTGTCTCGAAGGCTGGAGCGTTGTGGCAGCAAGGTTGCCGTTATGGGAGGACGACAAGGCCATGATGAAGTGGCTAGGTGGCCCATTGCATAGATGAC[A/T]
CGGGCAGCCTGGCCAAGGCGGCGATGATGGTAGCGCCATTTGGTGGGCATCAGCCCTCTTGCAGTGGCATCTCGCCACCACAAGATGGTCACGTGGGGGA
TCCCCCACGTGACCATCTTGTGGTGGCGAGATGCCACTGCAAGAGGGCTGATGCCCACCAAATGGCGCTACCATCATCGCCGCCTTGGCCAGGCTGCCCG[T/A]
GTCATCTATGCAATGGGCCACCTAGCCACTTCATCATGGCCTTGTCGTCCTCCCATAACGGCAACCTTGCTGCCACAACGCTCCAGCCTTCGAGACAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.60% | 4.30% | 11.60% | 2.52% | NA |
| All Indica | 2759 | 70.00% | 7.10% | 18.70% | 4.13% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Aus | 269 | 88.10% | 1.50% | 8.55% | 1.86% | NA |
| Indica I | 595 | 73.80% | 2.90% | 19.66% | 3.70% | NA |
| Indica II | 465 | 75.90% | 2.60% | 19.57% | 1.94% | NA |
| Indica III | 913 | 59.60% | 13.30% | 20.59% | 6.57% | NA |
| Indica Intermediate | 786 | 75.80% | 6.00% | 15.27% | 2.93% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414030990 | A -> DEL | N | N | silent_mutation | Average:22.68; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0414030990 | A -> T | LOC_Os04g24460.1 | downstream_gene_variant ; 1803.0bp to feature; MODIFIER | silent_mutation | Average:22.68; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0414030990 | A -> T | LOC_Os04g24460-LOC_Os04g24469 | intergenic_region ; MODIFIER | silent_mutation | Average:22.68; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414030990 | 4.07E-06 | NA | mr1404 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414030990 | 1.25E-06 | 4.40E-06 | mr1404 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |