\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414006438:

Variant ID: vg0414006438 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14006438
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATGCGGGGGGATGGGTGCACGGGAGGGGGGGTGGGGTGTATGGGGGTGGGTGTGAGGGGGAGCATTTTAGCTATTACACAACCTAAGTCTATGTGAGT[T/C]
TAGTATGTATGTGTATGTATATATATATAGAGAGAGAAGAGAGAGAGAGAGAGAGTATATAGAGGTGTATATACTCCCCCCGATTATCCATTAGCATCTG

Reverse complement sequence

CAGATGCTAATGGATAATCGGGGGGAGTATATACACCTCTATATACTCTCTCTCTCTCTCTCTTCTCTCTCTATATATATATACATACACATACATACTA[A/G]
ACTCACATAGACTTAGGTTGTGTAATAGCTAAAATGCTCCCCCTCACACCCACCCCCATACACCCCACCCCCCCTCCCGTGCACCCATCCCCCCGCATCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 0.10% 19.23% 13.90% NA
All Indica  2759 57.70% 0.10% 24.47% 17.76% NA
All Japonica  1512 88.80% 0.00% 4.37% 6.81% NA
Aus  269 41.30% 1.10% 38.66% 18.96% NA
Indica I  595 65.00% 0.00% 14.96% 20.00% NA
Indica II  465 51.20% 0.20% 33.98% 14.62% NA
Indica III  913 56.10% 0.00% 27.16% 16.76% NA
Indica Intermediate  786 57.90% 0.10% 22.90% 19.08% NA
Temperate Japonica  767 97.90% 0.00% 0.13% 1.96% NA
Tropical Japonica  504 85.70% 0.00% 11.90% 2.38% NA
Japonica Intermediate  241 66.40% 0.00% 2.07% 31.54% NA
VI/Aromatic  96 46.90% 0.00% 47.92% 5.21% NA
Intermediate  90 71.10% 0.00% 20.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414006438 T -> C LOC_Os04g24414.1 upstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:75.178; most accessible tissue: Callus, score: 95.426 N N N N
vg0414006438 T -> C LOC_Os04g24430.1 upstream_gene_variant ; 1807.0bp to feature; MODIFIER silent_mutation Average:75.178; most accessible tissue: Callus, score: 95.426 N N N N
vg0414006438 T -> C LOC_Os04g24414.3 upstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:75.178; most accessible tissue: Callus, score: 95.426 N N N N
vg0414006438 T -> C LOC_Os04g24414.2 upstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:75.178; most accessible tissue: Callus, score: 95.426 N N N N
vg0414006438 T -> C LOC_Os04g24414-LOC_Os04g24430 intergenic_region ; MODIFIER silent_mutation Average:75.178; most accessible tissue: Callus, score: 95.426 N N N N
vg0414006438 T -> DEL N N silent_mutation Average:75.178; most accessible tissue: Callus, score: 95.426 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0414006438 T C -0.01 -0.02 -0.02 0.04 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414006438 NA 5.09E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 7.19E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 4.43E-07 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 7.47E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 3.11E-06 1.96E-20 mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 3.35E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 9.78E-07 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 9.52E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 2.07E-07 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 2.38E-17 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 NA 6.82E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 2.19E-06 1.15E-36 mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414006438 1.69E-07 1.10E-24 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251