Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413988245:

Variant ID: vg0413988245 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13988245
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GATCTCGGCCGAGTCCAGGAGGCCGAACGGGGCGGAGATGGCATCTACTCCCGACTAGTTTAAATCCAAGTCGAGAAGAGAAATCTTGCCGAAGTTGTCG[G/A]
TGATGAAGTTAAGGCTGCCGAATCGGTATGCCTGCCCGGGAGGGAAGGCGAAGTCATCGATGCCTGAAACGGATCCCATCGCGCTTGTCGATGAAAAGCT

Reverse complement sequence

AGCTTTTCATCGACAAGCGCGATGGGATCCGTTTCAGGCATCGATGACTTCGCCTTCCCTCCCGGGCAGGCATACCGATTCGGCAGCCTTAACTTCATCA[C/T]
CGACAACTTCGGCAAGATTTCTCTTCTCGACTTGGATTTAAACTAGTCGGGAGTAGATGCCATCTCCGCCCCGTTCGGCCTCCTGGACTCGGCCGAGATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	9.20%	10.20%	1.52%	NA
All Indica	2759	72.20%	13.00%	14.64%	0.07%	NA
All Japonica	1512	93.70%	0.30%	1.39%	4.63%	NA
Aus	269	61.00%	22.30%	16.73%	0.00%	NA
Indica I	595	86.10%	5.50%	8.40%	0.00%	NA
Indica II	465	58.30%	12.50%	29.25%	0.00%	NA
Indica III	913	70.30%	18.00%	11.72%	0.00%	NA
Indica Intermediate	786	72.30%	13.40%	14.12%	0.25%	NA
Temperate Japonica	767	98.00%	0.00%	0.78%	1.17%	NA
Tropical Japonica	504	98.60%	0.40%	0.40%	0.60%	NA
Japonica Intermediate	241	69.70%	0.80%	5.39%	24.07%	NA
VI/Aromatic	96	96.90%	0.00%	3.12%	0.00%	NA
Intermediate	90	77.80%	12.20%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413988245	G -> DEL	N	N	silent_mutation	Average:36.841; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0413988245	G -> A	LOC_Os04g24400.1	upstream_gene_variant ; 206.0bp to feature; MODIFIER	silent_mutation	Average:36.841; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0413988245	G -> A	LOC_Os04g24390.1	downstream_gene_variant ; 1353.0bp to feature; MODIFIER	silent_mutation	Average:36.841; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0413988245	G -> A	LOC_Os04g24410.1	downstream_gene_variant ; 904.0bp to feature; MODIFIER	silent_mutation	Average:36.841; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N
vg0413988245	G -> A	LOC_Os04g24400-LOC_Os04g24410	intergenic_region ; MODIFIER	silent_mutation	Average:36.841; most accessible tissue: Zhenshan97 flower, score: 51.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413988245	NA	5.85E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	2.30E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	2.30E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	9.22E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	6.39E-08	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	1.02E-15	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	3.35E-11	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	5.71E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	4.22E-07	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	2.78E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	3.34E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	6.41E-07	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	7.21E-18	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	NA	2.89E-16	mr1830_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	6.60E-07	1.85E-29	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413988245	2.52E-07	3.25E-25	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251