\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413884424:

Variant ID: vg0413884424 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13884424
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.09, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGCCTCAATATCATGTCTACCATGTGTCGCGATACTGGAAAGTACCCGAATAGAGGCTGTGACAATACTCTCTGCACAACACAACTCACCACAGTGCA[T/C]
CGTTCCTGGATCATAATCTCCCCCTCAAAACCAGAGGCAATGGACTCCCCAGCGACCCCCACGGACTTCTCGCCGCTTCACAGTCTGACACACCATAATG

Reverse complement sequence

CATTATGGTGTGTCAGACTGTGAAGCGGCGAGAAGTCCGTGGGGGTCGCTGGGGAGTCCATTGCCTCTGGTTTTGAGGGGGAGATTATGATCCAGGAACG[A/G]
TGCACTGTGGTGAGTTGTGTTGTGCAGAGAGTATTGTCACAGCCTCTATTCGGGTACTTTCCAGTATCGCGACACATGGTAGACATGATATTGAGGCTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 17.30% 6.01% 7.09% NA
All Indica  2759 57.90% 28.30% 8.34% 5.44% NA
All Japonica  1512 88.80% 0.30% 1.46% 9.39% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 75.50% 11.40% 4.54% 8.57% NA
Indica II  465 19.10% 47.30% 20.00% 13.55% NA
Indica III  913 69.20% 26.30% 4.16% 0.33% NA
Indica Intermediate  786 54.30% 32.30% 9.16% 4.20% NA
Temperate Japonica  767 97.70% 0.10% 0.13% 2.09% NA
Tropical Japonica  504 86.70% 0.20% 2.18% 10.91% NA
Japonica Intermediate  241 65.10% 1.20% 4.15% 29.46% NA
VI/Aromatic  96 27.10% 19.80% 18.75% 34.38% NA
Intermediate  90 60.00% 13.30% 15.56% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413884424 T -> C LOC_Os04g24240.1 downstream_gene_variant ; 3106.0bp to feature; MODIFIER silent_mutation Average:18.76; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0413884424 T -> C LOC_Os04g24240-LOC_Os04g24250 intergenic_region ; MODIFIER silent_mutation Average:18.76; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N
vg0413884424 T -> DEL N N silent_mutation Average:18.76; most accessible tissue: Zhenshan97 root, score: 25.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413884424 NA 2.15E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 1.20E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 4.18E-09 mr1059 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 1.16E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 6.10E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 2.01E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 4.88E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 8.03E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 1.71E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 6.01E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 8.60E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 9.25E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 1.15E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413884424 NA 4.24E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251