Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413871126:

Variant ID: vg0413871126 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13871126
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACGGTTTTTTTGACTCATGTAGATGGATCGGCAATGGATGTACGCTGACCGGCGGTCCAAAGAGTTTATTGACGGCGTGCACTATTTTTTAGAGTGGCC[G/A]
AAGCTAACAGGCAAAGGGGTTTTATTTATTGTCCATGCAATAAGTGTAAGAATCAGAAGGAGTATTCTGCATCCAGGACTATTCATTTCCACTTGTTTGA

Reverse complement sequence

TCAAACAAGTGGAAATGAATAGTCCTGGATGCAGAATACTCCTTCTGATTCTTACACTTATTGCATGGACAATAAATAAAACCCCTTTGCCTGTTAGCTT[C/T]
GGCCACTCTAAAAAATAGTGCACGCCGTCAATAAACTCTTTGGACCGCCGGTCAGCGTACATCCATTGCCGATCCATCTACATGAGTCAAAAAAACCGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	0.10%	0.57%	56.60%	NA
All Indica	2759	24.20%	0.20%	0.87%	74.66%	NA
All Japonica	1512	85.10%	0.00%	0.07%	14.88%	NA
Aus	269	5.20%	0.00%	0.00%	94.80%	NA
Indica I	595	44.70%	0.20%	0.50%	54.62%	NA
Indica II	465	7.10%	0.40%	0.86%	91.61%	NA
Indica III	913	18.00%	0.00%	0.99%	81.05%	NA
Indica Intermediate	786	26.20%	0.40%	1.02%	72.39%	NA
Temperate Japonica	767	95.20%	0.00%	0.00%	4.82%	NA
Tropical Japonica	504	83.70%	0.00%	0.20%	16.07%	NA
Japonica Intermediate	241	55.60%	0.00%	0.00%	44.40%	NA
VI/Aromatic	96	13.50%	0.00%	0.00%	86.46%	NA
Intermediate	90	38.90%	1.10%	2.22%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413871126	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0413871126	G -> A	LOC_Os04g24230.1	upstream_gene_variant ; 159.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0413871126	G -> A	LOC_Os04g24240.1	upstream_gene_variant ; 4878.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0413871126	G -> A	LOC_Os04g24220.1	downstream_gene_variant ; 2866.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0413871126	G -> A	LOC_Os04g24220.3	downstream_gene_variant ; 2866.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0413871126	G -> A	LOC_Os04g24220.2	downstream_gene_variant ; 3047.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0413871126	G -> A	LOC_Os04g24220-LOC_Os04g24230	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413871126	NA	3.30E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413871126	NA	5.22E-06	mr1420_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413871126	NA	5.48E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413871126	NA	4.75E-06	mr1856_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251