\
| Variant ID: vg0413858051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13858051 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAATGACTGATGAGCGAAACAAGATGAGTGTGATTCCATATGCTTCGGCAATTGGATCCATCATGTATGCCATGTAATGTACATGTCCAGATGTTTCAT[A/T]
TGCACTTAGTGCAACAAGCCGATACCAATCAGATCCAGGTGAGTCACTGGATAGCTGTAAAGAATATCCTGAAGTACTTGAGAAGAACTAAGGATATGTT
AACATATCCTTAGTTCTTCTCAAGTACTTCAGGATATTCTTTACAGCTATCCAGTGACTCACCTGGATCTGATTGGTATCGGCTTGTTGCACTAAGTGCA[T/A]
ATGAAACATCTGGACATGTACATTACATGGCATACATGATGGATCCAATTGCCGAAGCATATGGAATCACACTCATCTTGTTTCGCTCATCAGTCATTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.00% | 9.80% | 3.70% | 5.52% | NA |
| All Indica | 2759 | 94.00% | 0.60% | 3.15% | 2.21% | NA |
| All Japonica | 1512 | 56.00% | 29.00% | 5.16% | 9.85% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 84.50% | 0.80% | 7.73% | 6.89% | NA |
| Indica II | 465 | 97.60% | 0.60% | 1.08% | 0.65% | NA |
| Indica III | 913 | 99.00% | 0.30% | 0.44% | 0.22% | NA |
| Indica Intermediate | 786 | 93.30% | 0.80% | 4.07% | 1.91% | NA |
| Temperate Japonica | 767 | 89.60% | 2.60% | 6.26% | 1.56% | NA |
| Tropical Japonica | 504 | 9.50% | 74.00% | 3.37% | 13.10% | NA |
| Japonica Intermediate | 241 | 46.10% | 19.10% | 5.39% | 29.46% | NA |
| VI/Aromatic | 96 | 52.10% | 0.00% | 2.08% | 45.83% | NA |
| Intermediate | 90 | 75.60% | 8.90% | 7.78% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413858051 | A -> DEL | LOC_Os04g24210.1 | N | frameshift_variant | Average:27.11; most accessible tissue: Callus, score: 40.067 | N | N | N | N |
| vg0413858051 | A -> T | LOC_Os04g24210.1 | missense_variant ; p.Met502Leu; MODERATE | nonsynonymous_codon ; M502L | Average:27.11; most accessible tissue: Callus, score: 40.067 | unknown | unknown | TOLERATED | 0.52 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413858051 | NA | 3.32E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.21E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.19E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.80E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.59E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 6.74E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.36E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.12E-08 | mr1295 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 7.33E-20 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.28E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.95E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.11E-08 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.06E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.11E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 3.25E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 4.58E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.55E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 4.26E-07 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 7.34E-12 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.58E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 6.32E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.40E-09 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 5.76E-07 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 5.15E-09 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 9.10E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 4.48E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 3.01E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 6.05E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 4.32E-14 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.29E-08 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 3.66E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 5.00E-10 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.06E-07 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 9.18E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.32E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 3.73E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 8.77E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.00E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 9.81E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 3.86E-20 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 7.29E-16 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.75E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.15E-12 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 4.06E-07 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.07E-07 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.22E-28 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 2.44E-16 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.46E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 5.70E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 1.08E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413858051 | NA | 6.65E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |