Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0413845447:

Variant ID: vg0413845447 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13845447
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


ACGACGACGCGCTACAGCGGCGGCGGCGGTGGCGGAGCTCCTCTCCAGCTCCACCTCGACTCCTTCCATGCCTCGACGTCGCCGCCGCCGTCCTACCACA[G/T]
GTACGCGCACACCAGCACGCCGCTCTTCCCAGCGTCCGGCGGCTATGGCTGGTTGTCGTCCAAGGAGCATTGCCTCACCCTCGGCGGCGCAGCCGACCTG

Reverse complement sequence

CAGGTCGGCTGCGCCGCCGAGGGTGAGGCAATGCTCCTTGGACGACAACCAGCCATAGCCGCCGGACGCTGGGAAGAGCGGCGTGCTGGTGTGCGCGTAC[C/A]
TGTGGTAGGACGGCGGCGGCGACGTCGAGGCATGGAAGGAGTCGAGGTGGAGCTGGAGAGGAGCTCCGCCACCGCCGCCGCCGCTGTAGCGCGTCGTCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 16.30% 1.59% 16.72% NA
All Indica  2759 46.90% 27.40% 2.39% 23.23% NA
All Japonica  1512 95.90% 0.30% 0.00% 3.84% NA
Aus  269 69.50% 0.00% 2.23% 28.25% NA
Indica I  595 68.10% 10.10% 4.37% 17.48% NA
Indica II  465 28.20% 48.00% 2.80% 21.08% NA
Indica III  913 41.40% 26.30% 0.99% 31.33% NA
Indica Intermediate  786 48.50% 29.80% 2.29% 19.47% NA
Temperate Japonica  767 96.10% 0.10% 0.00% 3.78% NA
Tropical Japonica  504 96.40% 0.00% 0.00% 3.57% NA
Japonica Intermediate  241 94.20% 1.20% 0.00% 4.56% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 68.90% 12.20% 3.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413845447 G -> DEL LOC_Os04g24190.1 N frameshift_variant Average:81.078; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N
vg0413845447 G -> T LOC_Os04g24190.1 missense_variant ; p.Arg338Met; MODERATE nonsynonymous_codon ; R338M Average:81.078; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 probably damaging 2.122 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0413845447 G T -0.03 -0.03 -0.03 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413845447 4.79E-06 4.79E-06 mr1664 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413845447 2.78E-06 NA mr1936 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251