\
| Variant ID: vg0413844880 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13844880 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATCTGACGTCCCTTAACTAATAAAAACCGGTCACAATAGATCCTTCGGTGGTTTTGACCCTGGTTTTTGTCTATGTGGCGACTGAGTCAGCGTGGGAC[C/T]
CACGTGTCAGGATGCCACGTCATCTCTCTTTCCCCTATTCTCTCCCTTCCTCAGATGGGGCCCACTTGTCAGGTGTCTCTTCTACCTCCTTCCCTGCGCC
GGCGCAGGGAAGGAGGTAGAAGAGACACCTGACAAGTGGGCCCCATCTGAGGAAGGGAGAGAATAGGGGAAAGAGAGATGACGTGGCATCCTGACACGTG[G/A]
GTCCCACGCTGACTCAGTCGCCACATAGACAAAAACCAGGGTCAAAACCACCGAAGGATCTATTGTGACCGGTTTTTATTAGTTAAGGGACGTCAGATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 7.10% | 2.41% | 16.50% | NA |
| All Indica | 2759 | 64.30% | 4.30% | 3.88% | 27.58% | NA |
| All Japonica | 1512 | 90.70% | 8.80% | 0.20% | 0.33% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.90% | 12.10% | 2.52% | 11.43% | NA |
| Indica II | 465 | 38.90% | 0.90% | 4.95% | 55.27% | NA |
| Indica III | 913 | 73.50% | 0.70% | 2.74% | 23.11% | NA |
| Indica Intermediate | 786 | 61.20% | 4.60% | 5.60% | 28.63% | NA |
| Temperate Japonica | 767 | 97.40% | 2.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 86.30% | 13.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 19.90% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 26.00% | 72.90% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 65.60% | 15.60% | 4.44% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413844880 | C -> DEL | N | N | silent_mutation | Average:62.354; most accessible tissue: Callus, score: 86.696 | N | N | N | N |
| vg0413844880 | C -> T | LOC_Os04g24200.1 | upstream_gene_variant ; 1877.0bp to feature; MODIFIER | silent_mutation | Average:62.354; most accessible tissue: Callus, score: 86.696 | N | N | N | N |
| vg0413844880 | C -> T | LOC_Os04g24180.1 | downstream_gene_variant ; 3619.0bp to feature; MODIFIER | silent_mutation | Average:62.354; most accessible tissue: Callus, score: 86.696 | N | N | N | N |
| vg0413844880 | C -> T | LOC_Os04g24180.2 | downstream_gene_variant ; 3619.0bp to feature; MODIFIER | silent_mutation | Average:62.354; most accessible tissue: Callus, score: 86.696 | N | N | N | N |
| vg0413844880 | C -> T | LOC_Os04g24190.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.354; most accessible tissue: Callus, score: 86.696 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413844880 | 1.77E-07 | NA | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413844880 | 4.77E-07 | 3.87E-09 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413844880 | 3.30E-06 | 4.10E-07 | mr1698_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413844880 | 4.66E-11 | NA | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413844880 | 3.72E-06 | 3.81E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413844880 | 2.40E-09 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |