Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413811955:

Variant ID: vg0413811955 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13811955
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAGGACACGACTCTTATCTCTAACAAATTCTAAGATACCATAAGTCTTTGCGGCATACTTTTGCCCAAACATATCTCTAAGGAAATTACATAAGATATC[C/A]
TAATTAATAGATACAATTGCCTATCTGAGAGCTTTATCTCCATCGTGGCAACCCTCGTGAAGCACATTGATCGATTCTAAAAACAACTCTGAAGCCGCCG

Reverse complement sequence

CGGCGGCTTCAGAGTTGTTTTTAGAATCGATCAATGTGCTTCACGAGGGTTGCCACGATGGAGATAAAGCTCTCAGATAGGCAATTGTATCTATTAATTA[G/T]
GATATCTTATGTAATTTCCTTAGAGATATGTTTGGGCAAAAGTATGCCGCAAAGACTTATGGTATCTTAGAATTTGTTAGAGATAAGAGTCGTGTCCTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	6.30%	0.06%	0.00%	NA
All Indica	2759	96.00%	4.00%	0.07%	0.00%	NA
All Japonica	1512	91.70%	8.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	88.10%	11.90%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.70%	0.25%	0.00%	NA
Temperate Japonica	767	97.80%	2.10%	0.13%	0.00%	NA
Tropical Japonica	504	87.70%	12.30%	0.00%	0.00%	NA
Japonica Intermediate	241	80.50%	19.50%	0.00%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413811955	C -> A	LOC_Os04g24160.1	downstream_gene_variant ; 3829.0bp to feature; MODIFIER	silent_mutation	Average:46.633; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg0413811955	C -> A	LOC_Os04g24140-LOC_Os04g24160	intergenic_region ; MODIFIER	silent_mutation	Average:46.633; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413811955	5.15E-06	NA	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	7.31E-11	NA	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	5.10E-07	5.49E-09	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	NA	6.62E-06	mr1698_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	1.65E-11	NA	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	5.29E-06	5.29E-06	mr1730_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	1.52E-06	3.03E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	2.39E-09	NA	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413811955	2.09E-06	2.09E-06	mr1912_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251