Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413775660:

Variant ID: vg0413775660 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13775660
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAGAGAAATGTCACATTAATTGGGGATACATTTTCTGACTTTTGCGTGTCATTTAAGCAATTTTAAAACTATAAAAATTAATGATATATATTTTTGTC[A/G]
TCGTATATAACTTGATAATAATTAAATTAGATCTAATAAAAGTAAATAAAAGTAAAATGAACAGATCTATGAGTAATATTAAAAAAAATACCCCCCCCAA

Reverse complement sequence

TTGGGGGGGGTATTTTTTTTAATATTACTCATAGATCTGTTCATTTTACTTTTATTTACTTTTATTAGATCTAATTTAATTATTATCAAGTTATATACGA[T/C]
GACAAAAATATATATCATTAATTTTTATAGTTTTAAAATTGCTTAAATGACACGCAAAAGTCAGAAAATGTATCCCCAATTAATGTGACATTTCTCTCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 6.90% 1.06% 0.00% NA
All Indica  2759 93.40% 5.00% 1.63% 0.00% NA
All Japonica  1512 91.40% 8.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.40% 11.30% 0.34% 0.00% NA
Indica II  465 85.20% 7.10% 7.74% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 95.20% 4.10% 0.76% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 87.10% 12.90% 0.00% 0.00% NA
Japonica Intermediate  241 78.40% 21.20% 0.41% 0.00% NA
VI/Aromatic  96 47.90% 51.00% 1.04% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413775660 A -> G LOC_Os04g24110.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER silent_mutation Average:23.514; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0413775660 A -> G LOC_Os04g24120.1 downstream_gene_variant ; 3171.0bp to feature; MODIFIER silent_mutation Average:23.514; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0413775660 A -> G LOC_Os04g24110-LOC_Os04g24120 intergenic_region ; MODIFIER silent_mutation Average:23.514; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413775660 2.24E-07 NA mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 1.07E-06 NA mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 2.23E-07 NA mr1866 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 5.60E-10 NA mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 3.22E-08 3.69E-11 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 7.01E-06 NA mr1368_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 2.71E-13 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 1.78E-08 1.78E-08 mr1730_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 1.59E-07 1.92E-08 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 5.00E-11 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413775660 1.71E-06 8.25E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251