\
| Variant ID: vg0413765723 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 13765723 |
| Reference Allele: GT | Alternative Allele: AT,G |
| Primary Allele: GT | Secondary Allele: AT |
Inferred Ancestral Allele: Not determined.
TAATGCCACCCGCCACAAACTTGTCCGGCAACTCACAGTTGTTGTTCTCAAGTTCCTTAGCCAGCATCTGAATCTCATGAGCTTGTTCTACTACAGAACG[GT/AT,G]
CATCGACCATCTTGTAGTCATAGAACTGCTCCATGACATACAGCTCACTGCCGGTGTCAGAAACTCCGAACTTGGCCTCAAGTGCATCCCACATGTCCTT
AAGGACATGTGGGATGCACTTGAGGCCAAGTTCGGAGTTTCTGACACCGGCAGTGAGCTGTATGTCATGGAGCAGTTCTATGACTACAAGATGGTCGATG[AC/AT,C]
CGTTCTGTAGTAGAACAAGCTCATGAGATTCAGATGCTGGCTAAGGAACTTGAGAACAACAACTGTGAGTTGCCGGACAAGTTTGTGGCGGGTGGCATTA
| Populations | Population Size | Frequency of GT(primary allele) | Frequency of AT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.00% | 5.40% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.20% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 91.70% | 7.50% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.60% | 10.60% | 0.84% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.70% | 10.30% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 19.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 43.80% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413765723 | GT -> G | LOC_Os04g24100.1 | frameshift_variant ; p.Asp271fs; HIGH | N | Average:33.701; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0413765723 | GT -> AT | LOC_Os04g24100.1 | synonymous_variant ; p.Asp271Asp; LOW | synonymous_codon | Average:33.701; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413765723 | 5.07E-06 | NA | mr1584 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 1.34E-07 | 4.69E-10 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 1.21E-07 | NA | mr1368_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 1.10E-06 | NA | mr1584_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 5.21E-12 | NA | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 3.60E-07 | 6.99E-08 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 8.93E-07 | NA | mr1853_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413765723 | 1.27E-09 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |