\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413752540:

Variant ID: vg0413752540 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13752540
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGAATGGTGTGCTGGCGAGGAGATCGGCGCTGAGCAATTGGGGGATCAGATTTCATCAATACGTATTCCTGAATGAGATGCTTCCACAGTTAGCTAAC[T/C]
CAACATGAAGATGAAATTATGTTTTGACCTTGGGTTGAAGATTTTCAGATACATACCTGCGGAGGCGGATTGAATGCGTTGTATGGTACAACTGGCAGTT

Reverse complement sequence

AACTGCCAGTTGTACCATACAACGCATTCAATCCGCCTCCGCAGGTATGTATCTGAAAATCTTCAACCCAAGGTCAAAACATAATTTCATCTTCATGTTG[A/G]
GTTAGCTAACTGTGGAAGCATCTCATTCAGGAATACGTATTGATGAAATCTGATCCCCCAATTGCTCAGCGCCGATCTCCTCGCCAGCACACCATTCAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 9.30% 11.57% 1.86% NA
All Indica  2759 66.00% 15.70% 17.25% 1.05% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 52.40% 0.70% 24.91% 21.93% NA
Indica I  595 86.60% 2.90% 9.75% 0.84% NA
Indica II  465 58.50% 16.30% 24.52% 0.65% NA
Indica III  913 56.60% 23.50% 19.17% 0.66% NA
Indica Intermediate  786 65.80% 15.90% 16.41% 1.91% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413752540 T -> C LOC_Os04g24070.1 downstream_gene_variant ; 2315.0bp to feature; MODIFIER silent_mutation Average:27.497; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0413752540 T -> C LOC_Os04g24080.1 intron_variant ; MODIFIER silent_mutation Average:27.497; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0413752540 T -> DEL N N silent_mutation Average:27.497; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413752540 NA 4.35E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 2.20E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 3.39E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 1.58E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 1.35E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 9.45E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 1.40E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 5.53E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 9.84E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 3.79E-07 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 7.16E-08 mr1757 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 3.79E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 7.99E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 7.87E-06 mr1931 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 7.23E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413752540 NA 2.70E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251